SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 12 of 12
Search took 0.00 seconds.
Search: Posts Made By: quokka
Forum: Bioinformatics 09-26-2019, 02:55 AM
Replies: 35
Views: 27,198
Posted By quokka
Hi, I'm trying to use BBMap version 38.08 to...

Hi,

I'm trying to use BBMap version 38.08 to retrieve fastq sequences from a bam file. However, I keep getting a problem where the quality output is merely:...
Forum: Illumina/Solexa 08-05-2018, 02:37 PM
Replies: 2
Views: 1,702
Posted By quokka
An answer to this question on biostars

An answer to this question on biostars:

https://www.biostars.org/p/329614/#329623
Forum: Illumina/Solexa 07-29-2018, 06:21 PM
Replies: 2
Views: 1,702
Posted By quokka
Opinion on FastQC output for HiSeq 4000 PE sequencing run

Hello,

I recently had four 400bp insert plant DNA libraries sequenced (2x150bp) using one HiSeq 4000 lane.

I've attached FastQC outputs for R1 and R2 of one of these libraries.

It seems...
Forum: Metagenomics 01-17-2017, 09:03 PM
Replies: 0
Views: 2,026
Posted By quokka
megahit failing without an error message in (x)ubuntu virtual machine

Hi.

I can get megahit (v1.1) to work as expected (either by compiling it myself or using precompiled binaries) on our cluster with CentOS (6.8).

The same version of megahit initially appears to...
Forum: Bioinformatics 12-01-2015, 08:15 PM
Replies: 6
Views: 3,478
Posted By quokka
Ok...it took me a long time before i was able to...

Ok...it took me a long time before i was able to get back to this......

I essentially tried what tomc suggested. The problem I found was that the e-values were a bit different to what I was...
Forum: Bioinformatics 04-02-2015, 07:35 PM
Replies: 6
Views: 3,478
Posted By quokka
Thanks very much for the info Genomax....very...

Thanks very much for the info Genomax....very helpful!

The queues on our cluster for machines with >24GB physical memory (22GB available) are exceptionally long.....so 18GB sounds good....
...
Forum: Bioinformatics 04-01-2015, 12:25 AM
Replies: 6
Views: 3,478
Posted By quokka
ah.....I left it go for a long time and...

ah.....I left it go for a long time and eventually an insufficient memory error came up.....so that was it....

It wasn't clear to me what the memory requirements for blast+ were (and whether...
Forum: Bioinformatics 03-31-2015, 04:54 PM
Replies: 6
Views: 3,478
Posted By quokka
TBLASTX with nt database and PBS PRO job scheduler

Hi I'm wondering if someone might be able to help.

I'm attempting to do a TBLASTX search with 5 query sequences (each about ~1kb in size) against the nt database from NCBI (28990570 sequences).
...
Forum: Bioinformatics 01-05-2015, 12:02 AM
Replies: 2
Views: 1,326
Posted By quokka
mpiBLAST is inserting the path into the subject...

mpiBLAST is inserting the path into the subject name for some reason...so switching to a shorter path for the input might be required....hmmmn....I don't recall this being an issue before.....oh...
Forum: Bioinformatics 01-04-2015, 03:44 PM
Replies: 2
Views: 1,326
Posted By quokka
Problem with mpiBLAST output subject sequence names

Hi all,

I'm experiencing an issue when running mpiBLAST 1.6.0 on our cluster. It runs fine however the results (from a TBLASTX run) do not have the complete name of the subject sequence in the...
Forum: Bioinformatics 10-03-2013, 12:18 PM
Replies: 2
Views: 2,723
Posted By quokka
Ah...thanks so much Devon. Thank god someone has...

Ah...thanks so much Devon. Thank god someone has read the manual!...
Forum: Bioinformatics 10-02-2013, 07:04 PM
Replies: 2
Views: 2,723
Posted By quokka
Exclamation Bowtie2 is unable to align query sequences that contain an intervening stretch of N's

If I have a reference sequence:
>reference
CTAGAATATCACTTAGGCCGGTATTCTATTACTGTACTTCGCGTAAGCTGCTTTAACCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...
Showing results 1 to 12 of 12

 


All times are GMT -8. The time now is 06:02 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO