SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 36
Search took 0.01 seconds.
Search: Posts Made By: vishwesh
Forum: Bioinformatics 07-29-2017, 02:10 PM
Replies: 0
Views: 975
Posted By vishwesh
Mirplex error

Hi, I am using mirplex to identify novel micrornas in plants. When I run it I get the following error. Can some one please help me solve this..

Jul 30, 2017 5:57:16 AM...
Forum: Bioinformatics 04-11-2016, 05:53 AM
Replies: 2
Views: 973
Posted By vishwesh
Thanks.. In the result summary I get a value for...

Thanks.. In the result summary I get a value for Containment. What dos that mean...
I get result like
Unique - xxxxxx
Containment - yyyyy
Result - zzzzz

Regards
Vishwesh
Forum: Bioinformatics 04-11-2016, 05:43 AM
Replies: 2
Views: 973
Posted By vishwesh
separate the unique and redundant reads from the raw data

Hi, I have raw deep seq data (micro rna data). I want to separate the unique and redundant reads from the raw data. Is there any tools to identify the unique and redundant reads??

Thanks
...
Forum: Bioinformatics 02-25-2016, 06:25 AM
Replies: 4
Views: 1,832
Posted By vishwesh
No I dint... Will give a try... Thanks..

No I dint... Will give a try...

Thanks..
Forum: Bioinformatics 02-25-2016, 04:52 AM
Replies: 4
Views: 1,832
Posted By vishwesh
Thanks... No error or warning is posted.. ...

Thanks...
No error or warning is posted..
The message after executing the build command is

running build_ext

Thats all...

Regards
Vishwesh
Forum: Bioinformatics 02-25-2016, 12:32 AM
Replies: 4
Views: 1,832
Posted By vishwesh
cutadapt 1.9.1 error

Hi,
When i try to use cutadapt without installation I get the following error.

[USER@user cutadapt-1.9.1]$ python2.6 ./bin/cutadapt --help

ERROR: A required extension module could not be...
Forum: Bioinformatics 06-30-2015, 11:41 PM
Replies: 1
Views: 672
Posted By vishwesh
Finding genes expressed specific to tissues

0
gravatar for vishweshwaransridhar
6 minutes ago by
vishweshwaransridhar 0
Singapore

Hi All,

I have requirement. Say suppose if I want to find the all the details of a gene in...
Forum: RNA Sequencing 01-15-2015, 01:00 AM
Replies: 0
Views: 919
Posted By vishwesh
De error

Hi,
I get the following error when trying to do a DE analysis.
/trinityrnaseq_r20140413/Analysis/DifferentialExpression/analyze_diff_expr.pl --matrix Trinity_trans.TMM.fpkm.matrix -P 1e-3 -C 2...
Forum: Bioinformatics 01-08-2015, 08:45 PM
Replies: 0
Views: 855
Posted By vishwesh
Find function of contigs from denovo assembly.

Hi,
I have did a denovo assembly on RNA seq data. On mapping the contigs there are few genes whose functions are unknown. I want to find the function of these genes.

Is there any method to...
Forum: Bioinformatics 12-11-2014, 01:51 AM
Replies: 4
Views: 1,846
Posted By vishwesh
Does this warning message create any problem in...

Does this warning message create any problem in alignment??
Forum: Bioinformatics 12-11-2014, 01:00 AM
Replies: 4
Views: 1,846
Posted By vishwesh
Warning Message - Blast

Hi,
When I run blast I get the following warning message. I get this when running transcripts from denovo assembly.

Warning: (1431.1) CFastaReader: Title is very long: 1081 characters (max is...
Forum: Bioinformatics 06-25-2014, 02:58 AM
Replies: 0
Views: 1,468
Posted By vishwesh
Trinotate - sqlite error.

Hi,
When I run the following command
$ Trinotate Trinotate.sqlite init --gene_trans_map /home/new/trinity_targets.gene_trans_map --transcript_fasta /home/new/trinity_targets.fasta...
Forum: Bioinformatics 06-17-2014, 01:24 AM
Replies: 5
Views: 1,604
Posted By vishwesh
Thanks. Our aim is to find novel micro RNA. Can...

Thanks. Our aim is to find novel micro RNA. Can this be done with denovo assembly?

Vishwesh
Forum: Bioinformatics 06-06-2014, 01:39 AM
Replies: 0
Views: 1,896
Posted By vishwesh
transdecoder

Hi,
Has anyone used Transdecoder from trinotate (Trinity denovo assembly).
Here is my problem. I using transdecoder for gene ontology of assembled contigs. When I run Transdecoder with the...
Forum: Bioinformatics 06-01-2014, 10:07 PM
Replies: 1
Views: 665
Posted By vishwesh
unique reads

Hi,
I need to count the number of unique reads after the adapter sequence is removed from the reads by cutadapt.
Can some help me get the unique reads count..

Thanks
Vishwesh
Forum: Bioinformatics 05-29-2014, 07:15 AM
Replies: 5
Views: 1,604
Posted By vishwesh
I want to make a assembly to for finding existing...

I want to make a assembly to for finding existing micro RNA and novels ones also... Since there is no reference genome for the species I deal with I thought I could try to build the hairpin structure...
Forum: Bioinformatics 05-29-2014, 01:46 AM
Replies: 5
Views: 1,604
Posted By vishwesh
denovo assembly for small rna sequencing

Hi,
I am working on small RNA reads for micro RNA analysis. I am using velvet for denovo assembly. Can some one suggest a good tool for denovo assembly for small rna reads.

Regards
Vishwesh
Forum: Bioinformatics 04-09-2014, 12:26 AM
Replies: 1
Views: 817
Posted By vishwesh
Target of a gene.

Hi,
Is there any tool to find the target of gene. Say suppose there is a gene A. The product of a gene A targets gene B. I would like to know if there is a tool which can find target gene B on...
Forum: Bioinformatics 03-27-2014, 08:33 AM
Replies: 4
Views: 1,692
Posted By vishwesh
Thanks for the response. Hope the command that...

Thanks for the response.
Hope the command that I use is correct.
Can you pls let me know how remove 5' adapter and 3' adapter using cutadapt??

Regards
Vishwesh
Forum: Bioinformatics 03-27-2014, 08:20 AM
Replies: 4
Views: 1,692
Posted By vishwesh
Cutadapt - help.

Hi,
I am using cutadapt for removing the adapter sequence. I have 2 adapter sequence.

RNA 5Adapter (RA5)
5 GUUCAGAGUUCUACAGUCCGACGAUC
RNA 3?Adapter (RA3)
5 TGGAATTCTCGGGTGCCAAGG
...
Forum: Bioinformatics 03-27-2014, 08:17 AM
Replies: 132
Views: 52,026
Posted By vishwesh
Hi, I am using cutadapt for removing the...

Hi,
I am using cutadapt for removing the adapter sequence. I have 2 adapter sequence.

RNA 5Adapter (RA5)
5 GUUCAGAGUUCUACAGUCCGACGAUC
RNA 3?Adapter (RA3)
5 TGGAATTCTCGGGTGCCAAGG
...
Forum: Bioinformatics 02-25-2014, 11:43 PM
Replies: 1
Views: 1,052
Posted By vishwesh
sam file as input in velvet

Hi,
I running velveth with sam file as input. I get the following error.

Segmentation fault (core dumped)

I dont get any error when I run the velveth with fasta file as input.

Here...
Forum: Bioinformatics 02-04-2014, 12:53 AM
Replies: 1
Views: 1,286
Posted By vishwesh
Assembled contigs to proteins

Hi,
Can somebody suggest tool for converting the assembled contigs from de novo assembly to proteins for homology studies.

Regards
Vishwesh
Forum: Bioinformatics 01-14-2014, 02:03 AM
Replies: 1
Views: 2,149
Posted By vishwesh
Bowtie to get unmapped reads.

Hi,
I am interested in extracting the unmapped reads. I am using is unparied reads.
Here is the command I use.
bowtie2 -p 8 --no-head --no-unal -x /home/index/allothrnaut -U...
Forum: Bioinformatics 01-13-2014, 09:21 PM
Replies: 4
Views: 2,541
Posted By vishwesh
Where can I find stdout and stderr...??

Where can I find stdout and stderr...??
Showing results 1 to 25 of 36

 


All times are GMT -8. The time now is 12:03 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO