SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 66
Search took 0.03 seconds.
Search: Posts Made By: eab
Forum: Sample Prep / Library Generation 05-14-2019, 12:11 PM
Replies: 0
Views: 741
Posted By eab
How to make oligo-dT bind tighter

Has anyone tried chemical modifications to oligo-dT-VN to increase binding affinity to mRNA molecules? For example, are LNA bases helpful? We're developing a bead-based mRNA recovery method, and...
Forum: Sample Prep / Library Generation 10-02-2018, 08:15 AM
Replies: 0
Views: 770
Posted By eab
Template-switching RTase preferences

Does anyone out there have strong feelings about which RTase enzymes are best for transcriptome library prep using template-switch oligos? Apparently, SmartScribe is Clontech's favorite. Others...
Forum: Epigenetics 07-19-2018, 12:22 PM
Replies: 0
Views: 2,842
Posted By eab
Best device for chromatin shearing/ChIP-seq?

We would like to purchase a system for chromatin shearing to allow ChIP and ChIP-seq studies. Does anyone have recommendations for systems to consider, or avoid?
Thanks!
Eli
Forum: Sample Prep / Library Generation 08-18-2015, 10:44 AM
Replies: 282
Views: 139,298
Posted By eab
Superscript II concerns

We would like to know anyone thinks our single-cell transcriptome results may be questionable due to the issue with superscript II that several people have raised. We've been using at least one of...
Forum: Sample Prep / Library Generation 06-20-2015, 03:51 PM
Replies: 6
Views: 1,302
Posted By eab
what if the RNA is degraded, and there's just a...

what if the RNA is degraded, and there's just a tiny bit of it? think SMARTseq2 on a single cell laser captured from an FFPE section.
ever try SMARTer on degraded RNA, as a 3' end sequencing...
Forum: Sample Prep / Library Generation 06-19-2015, 08:07 PM
Replies: 6
Views: 1,302
Posted By eab
thanks for your reply! i've heard a bit about...

thanks for your reply!
i've heard a bit about that method, not sure how it works exactly, but sadly i do think we need to remove after the libraries are already made.
the reason is i fear there's...
Forum: Sample Prep / Library Generation 06-19-2015, 07:37 PM
Replies: 6
Views: 1,302
Posted By eab
Removing rRNA at the DNA stage

We need to be able to remove rRNA-derived library molecules from PCR amplified mRNAseq library, rather than removing the rRNA itself during the earlier steps of library construction. We don't need...
Forum: Sample Prep / Library Generation 06-08-2015, 11:24 AM
Replies: 0
Views: 926
Posted By eab
Can't make RNA fragments <100 bp with heat/magnesium

We have observed that no matter how long we cook human total RNA in the presence of magnesium, we never get fragments smaller than about 100 bp. I'm not complaining, but I don't understand it. Does...
Forum: Sample Prep / Library Generation 05-07-2015, 06:04 AM
Replies: 4
Views: 1,325
Posted By eab
Thanks to both! You raise good points. We are...

Thanks to both! You raise good points. We are experienced with controlling the size cut using AMPure (or PAGE, when absolutely necessary), so I have confidence there. If we wanted strand specific,...
Forum: Sample Prep / Library Generation 05-06-2015, 11:59 AM
Replies: 4
Views: 1,325
Posted By eab
Best way to stick adaptors on degraded mRNA

We need to make Illumina libraries from small quantities (<1ng) of human mRNA than has been degraded to a fragment size <150 nt.

We can do this by randomly-primed RT, second strand synth, end prep...
Forum: Sample Prep / Library Generation 03-19-2015, 11:32 AM
Replies: 282
Views: 139,298
Posted By eab
rRNA signal in SMARTseq2

What rRNA read percentages do people typically get using this protocol? We made a batch of libraries recently with rRNA percentages ~50%. Seems too high. Does anyone have thoughts about potential...
Forum: Sample Prep / Library Generation 11-13-2014, 01:01 AM
Replies: 18
Views: 5,194
Posted By eab
Has anyone had any further progress with this...

Has anyone had any further progress with this device?
Forum: Sample Prep / Library Generation 08-11-2014, 07:43 AM
Replies: 12
Views: 11,657
Posted By eab
i frequently freeze beads under water sup during...

i frequently freeze beads under water sup during elution and then thaw, incubate, and remove beads later

if you freeze the raw ampure solution i'm not sure what happens, it's pretty concentrated...
Forum: Sample Prep / Library Generation 07-09-2014, 06:18 AM
Replies: 282
Views: 139,298
Posted By eab
Also, if one were to leave out the betaine, you...

Also, if one were to leave out the betaine, you would predict a lower yield of library, and bias in the data due to selective loss of reads from transcripts with strong secondary structures?
Forum: Sample Prep / Library Generation 07-09-2014, 06:15 AM
Replies: 282
Views: 139,298
Posted By eab
Simone, Really appreciate all your advice on...

Simone,
Really appreciate all your advice on this forum.
How much have you played with the concentration of betaine during the RT, or investigated other duplex destabilizers?
Many thanks for any...
Forum: Sample Prep / Library Generation 06-27-2014, 08:42 AM
Replies: 0
Views: 712
Posted By eab
Difficulties with A tailing

Our mRNA libraries have been looking funny lately, and it appears that the issue may be residual 3'>5' exonuclease activity in the Klenow we have been using for A tailing.

Does anyone have a...
Forum: Sample Prep / Library Generation 11-21-2013, 10:05 AM
Replies: 1
Views: 1,648
Posted By eab
RNASeq by Nextera vs. Standard

Does anyone out there strongly prefer either Nextera or standard (TruSeq) library construction for RNAseq?

I use a version of the standard protocol, which is familiar to me, not fast but...
Forum: Sample Prep / Library Generation 09-17-2013, 01:01 PM
Replies: 1
Views: 2,120
Posted By eab
Illumina Multiplexing Primer 2.0

A collaborator has prepared a custom library for our sequencing by amplifying with the following primers.

Multiplexing PCR Primer 1.0:
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
...
Forum: Sample Prep / Library Generation 09-02-2013, 05:31 AM
Replies: 13
Views: 6,081
Posted By eab
Hmm! Those two weren't even on my radar screen. ...

Hmm! Those two weren't even on my radar screen. Did you look at the Caliper machines or the IntegenX Apollo system at all?

What are your thoughts about the Qiagen and Eppendorf machines?
Forum: Sample Prep / Library Generation 09-02-2013, 03:23 AM
Replies: 13
Views: 6,081
Posted By eab
What liquid handling system(s) did you choose, by...

What liquid handling system(s) did you choose, by the way?
Forum: Sample Prep / Library Generation 09-01-2013, 11:39 AM
Replies: 13
Views: 6,081
Posted By eab
Thanks very much, that is helpful. Does...

Thanks very much, that is helpful.

Does anyone think fragmentase or other enzymatic solution will in any way replace accoustic shearing?
Forum: Sample Prep / Library Generation 09-01-2013, 03:21 AM
Replies: 13
Views: 6,081
Posted By eab
OK, thanks, that is helpful. Yes, only Illumina,...

OK, thanks, that is helpful. Yes, only Illumina, Miseq and Hiseq, now mostly TruSeq RNA and amplicon. SMARTer may be heavily used in the future, provided no alternative for single-cell libraries...
Forum: Sample Prep / Library Generation 08-30-2013, 11:56 AM
Replies: 13
Views: 6,081
Posted By eab
Thanks very much for your reply. I had forgotten...

Thanks very much for your reply. I had forgotten about Nextera! But my sense is that's not going to put Covaris out of business - do you agree? Even if bias improves?

If we're doing, say, lots...
Forum: Sample Prep / Library Generation 08-30-2013, 11:42 AM
Replies: 13
Views: 6,081
Posted By eab
alternatives to Covaris

We are starting a sequencing core and considering whether to buy a Covaris machine. Do people think fragmentation of gDNA or full-length message cDNA (a la SMARTer ultra low for RNASeq) is going to...
Forum: Sample Prep / Library Generation 08-01-2013, 05:08 AM
Replies: 2
Views: 1,822
Posted By eab
automated library prep for mRNA

Does anyone have any thoughts about the best system for automated library prep in mRNA seq? Criteria include the following:

1 - Throughput
2 - Minimum sample requirements
3 - Ability to enrich...
Showing results 1 to 25 of 66

 


All times are GMT -8. The time now is 12:09 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO