SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 32
Search took 0.00 seconds.
Search: Posts Made By: pony2001mx
Forum: Bioinformatics 08-20-2014, 12:22 AM
Replies: 1
Views: 1,257
Posted By pony2001mx
How to make website like TargetScan?

Dear All
Attached is a snap picture of TargetScan website. TargetScan is a tool for prediction of miRNA targets. On that website, when clicking on specific target site, it will display sequence...
Forum: Bioinformatics 07-15-2014, 07:03 AM
Replies: 0
Views: 1,793
Posted By pony2001mx
Needleman-Wunsch perl script

Dear all,
Actually i posted a similar question on Biostars about usage of Needleman perl module.
i have problem with the following script (kind helps from a biostars member). Could anyone help to...
Forum: Bioinformatics 05-04-2014, 05:12 PM
Replies: 6
Views: 1,720
Posted By pony2001mx
Hi SNPSaurus, Thank you very much! It's really...

Hi SNPSaurus, Thank you very much! It's really good stuff for me to learn. Thanks.
Forum: Bioinformatics 05-04-2014, 05:28 AM
Replies: 6
Views: 1,720
Posted By pony2001mx
Hi SNPSaurus, Thanks a lot for your comments!...

Hi SNPSaurus,
Thanks a lot for your comments! Actually it's not so easy. If the input data is as follows, then it's ok.
sample1 mir1 1.1
sample1 mir2 1.2
sample2 mir1 2.1
sample2 mir2 2.2
...
Forum: Bioinformatics 05-03-2014, 05:54 PM
Replies: 6
Views: 1,720
Posted By pony2001mx
Hi mastal, I still have problem, but thanks a lot...

Hi mastal, I still have problem, but thanks a lot anyway.
Forum: Bioinformatics 05-02-2014, 06:45 AM
Replies: 6
Views: 1,720
Posted By pony2001mx
Perl script: Make Statistics Of Mirna Abundances For Many Samples

Dear All,

Actually I post the following question a few weeks ago on Biostars (https://www.biostars.org/p/97538/#97599). I got a very nice answer there, but it's perl one liner command. I am...
Forum: Bioinformatics 01-17-2014, 07:32 PM
Replies: 2
Views: 1,428
Posted By pony2001mx
Thank you very much, SNPsaurus. You comment is...

Thank you very much, SNPsaurus. You comment is really helpful!
Forum: Bioinformatics 01-16-2014, 07:00 PM
Replies: 2
Views: 1,428
Posted By pony2001mx
perl script to generate six frame sequences

Hi everyone
I wrote a script to generate siz frame sequences (+1 +2 +3 -1 -2 -3 frames). However, it only works on frames +1 +2 +3 -1. For example the following is -3 frame sequence...
Forum: Bioinformatics 12-18-2013, 04:20 AM
Replies: 5
Views: 4,649
Posted By pony2001mx
Hi GenoMax, Lindenb's solution...

Hi GenoMax,

Lindenb's solution (https://github.com/lindenb/jvarkit/wiki/BlastnToSnp) should be a nice one. I am performing blast for short sequences and testing his java program.

I am a...
Forum: Bioinformatics 12-17-2013, 08:04 PM
Replies: 5
Views: 4,649
Posted By pony2001mx
Thank you very much. I have sorted it out.

Thank you very much. I have sorted it out.
Forum: Bioinformatics 12-16-2013, 11:28 PM
Replies: 5
Views: 4,649
Posted By pony2001mx
How to identify mismatch and gap positions

Dear all,

I need to identify the homologs of many short sequences, and then make statistics of the mismatch and gap positions between each short sequence and its homolog. The first step can be...
Forum: Bioinformatics 12-16-2013, 11:09 PM
Replies: 2
Views: 1,417
Posted By pony2001mx
Hi Liy, Thanks a lot! It's really what I...

Hi Liy,

Thanks a lot! It's really what I need.

Best,

X
Forum: Bioinformatics 12-16-2013, 09:44 PM
Replies: 2
Views: 1,417
Posted By pony2001mx
How to generate random short sequences

Dear all,

I need to generate some fake miRNAs as negative control. To speak more specificlly, I need to generate a few hundred random 21 nt - 24 nt sequences based on the genome fasta file.
...
Forum: Bioinformatics 12-02-2013, 08:32 PM
Replies: 8
Views: 2,582
Posted By pony2001mx
Thank you both. This script works well. ...

Thank you both. This script works well. Personally I will continue learning perl, which is powerful for genomic analysis. THANKS.
Forum: Bioinformatics 12-02-2013, 05:01 PM
Replies: 8
Views: 2,582
Posted By pony2001mx
Hi, gringer, there still exists problems. My...

Hi, gringer, there still exists problems. My input file is:

ATGCACTGACTGTATGACTG
ATGGTGACTGTGACTGACTG
ATGGACCATGACTGCATGTG
ATCCACTGTGACGTGCAACA

my output file is:
0.25CACTGACTGTATGACTG...
Forum: Bioinformatics 12-02-2013, 05:05 AM
Replies: 8
Views: 2,582
Posted By pony2001mx
The last line of your script lacks a "(". After...

The last line of your script lacks a "(". After adding it, i found no error message, but i did not get any output. Could you check it please? THANKS.
Forum: Bioinformatics 12-02-2013, 04:49 AM
Replies: 8
Views: 2,582
Posted By pony2001mx
Dear gringer, thank you very much for your...

Dear gringer,

thank you very much for your detailed corrections. I am new in perl programming, especially the perl grammer. My script is based on others' advices, but i had troubles in...
Forum: Bioinformatics 12-01-2013, 08:45 PM
Replies: 8
Views: 2,582
Posted By pony2001mx
script to calculate A,T,G,C frequency for each position in an alingment

Dear all,
I am new in programming. I wrote a script to calculate the A,T,G,C frequency for each position in an alignment. Take the following alignment for example, in the position 1 the A frequency...
Forum: Bioinformatics 11-20-2013, 03:45 AM
Replies: 3
Views: 1,118
Posted By pony2001mx
thank you for your suggestions!

thank you for your suggestions!
Forum: Bioinformatics 11-19-2013, 05:08 AM
Replies: 3
Views: 1,118
Posted By pony2001mx
Sorry, I failed uploading the images. Please find...

Sorry, I failed uploading the images. Please find the image here. THANKS.
Forum: Bioinformatics 11-19-2013, 04:53 AM
Replies: 3
Views: 1,118
Posted By pony2001mx
graph for relationship of homologous genes

Dear All,
Could you please inform me what softwares can be used to generate the following graphs. Both depict relations of synteny blocks. I only focus on ~100 hundred genes in three genomes. I...
Forum: Bioinformatics 11-12-2013, 05:35 PM
Replies: 6
Views: 4,100
Posted By pony2001mx
THANKS a lot for your suggestions, which are...

THANKS a lot for your suggestions, which are really helpful!
Forum: Bioinformatics 11-11-2013, 04:59 AM
Replies: 6
Views: 4,100
Posted By pony2001mx
perl script to exact sequences by name list

Dear All,
i am a perl beginner. Recently i wrote a script to extract multiple sequences from a fasta file. The following is an example.

FASTA FILE:
>gene1
cgcggccccccccccccccccccc
>gene2...
Forum: Bioinformatics 10-22-2013, 11:34 PM
Replies: 10
Views: 2,528
Posted By pony2001mx
Thank you all for your inputs. As a true beginner...

Thank you all for your inputs. As a true beginner of perl (I am mostly involved in bench work), I will persits on learning perl. THANKS for your help!
Forum: Bioinformatics 10-22-2013, 07:19 AM
Replies: 10
Views: 2,528
Posted By pony2001mx
Thank you very much!

Thank you very much!
Showing results 1 to 25 of 32

 


All times are GMT -8. The time now is 02:48 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO