SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 49
Search took 0.00 seconds.
Search: Posts Made By: memento
Forum: Bioinformatics 07-19-2017, 11:13 AM
Replies: 0
Views: 608
Posted By memento
RNAseq bam to variants calling (GATK, Mutect1/2

Has anyone prepped rnaseq bam files for mutect/gatk? i found some pdf with pipeline schematics, but could not understand step by step prep. what are tools/settings needed to preprocess bam for...
Forum: Bioinformatics 08-05-2014, 06:12 AM
Replies: 4
Views: 1,435
Posted By memento
1) RNA was qced using Nanodrop + 2d gel 2)...

1) RNA was qced using Nanodrop + 2d gel
2) Whole reads are polyA (or T), both on 50bp SE (HiSeq) and 250bp(MiSeq, did it just out of curiosity as a part of other run). mRNA polyA is between...
Forum: Bioinformatics 08-04-2014, 08:32 AM
Replies: 4
Views: 1,435
Posted By memento
A lot of Poly-A after RNAseq completed

Hi,
Is there any obvious explanation why there would be a lot (~50%) of poly-A (or Poly-T, since this was bidirectional lib prep) in the output ?
RNA was purified using Poly-A+ enrichment (purified...
Forum: Illumina/Solexa 03-06-2014, 09:46 AM
Replies: 0
Views: 1,051
Posted By memento
ChIPseq - how to qc the results ?

Hi,
I just received our first chipseq sequencing results. I tried to use 2 packages to get the interesting peaks (MACS and Homer). Homer produces various qc graphs that seem to be fine,...
Forum: Sample Prep / Library Generation 02-23-2014, 06:42 AM
Replies: 0
Views: 1,005
Posted By memento
Agilent Exome - what are the required capture buffers ?

I just ordered the Agilent's capture probes. I have an experience with custom agilent kits. It just looks like I will run out of hyb and wash buffers soon (from other, agilent custom kit). Do they...
Forum: Illumina/Solexa 02-12-2014, 07:18 PM
Replies: 37
Views: 40,053
Posted By memento
I always use the following formula and it never...

I always use the following formula and it never let me down. It considers that the complete length of Your library (on average) is ~350bp (~250bp insert + 100bp adaptors). After pooling of samples...
Forum: Illumina/Solexa 10-31-2013, 08:05 AM
Replies: 1
Views: 1,373
Posted By memento
lack of blocking primer in pre and post hyb...

Hi,
It looks like I made a mistake in the hybridization library prep. Following the Rohland2012 protocol I forgot to use truncaded primers for pre-hyb (6 cycles). I used the fully indexed and flow...
Forum: Illumina/Solexa 08-01-2013, 10:25 AM
Replies: 7
Views: 7,988
Posted By memento
thats a great point, truncating the index from 8...

thats a great point, truncating the index from 8 to 7 (as long as the indices are "different" enough)...
thanks!
Forum: Illumina/Solexa 07-31-2013, 06:53 PM
Replies: 7
Views: 7,988
Posted By memento
Mixing different types of indexes on the same MiSeq run ??

Is it possible to mix lets say, two libraries in the same run, but the indexing would be 7nt for first one, and 8nt for the second one ? Of course the shorter one is completely different (index...
Forum: Illumina/Solexa 07-31-2013, 06:49 PM
Replies: 0
Views: 1,897
Posted By memento
Best method/kit for rRNA depletion

I am looking for a lib prep for RNAseq. It seems that rRNA is a crucial step (plant/human). What would You recommend ? Is there any way to do inhouse rRNA depletion (no commercial kit) ? Can You do...
Forum: Illumina/Solexa 07-17-2013, 10:01 AM
Replies: 30
Views: 23,590
Posted By memento
For the custom libraries we had a hard time using...

For the custom libraries we had a hard time using RT quantification (always overestimating). We were using PhiX as a standard though. Currently the best way for us is to use gel cuts followed by...
Forum: Illumina/Solexa 07-17-2013, 09:52 AM
Replies: 2
Views: 1,086
Posted By memento
Based on TruSeq library, You absolutely have to...

Based on TruSeq library, You absolutely have to run it the same day after multiplexing is finished. This will ensure ~800k/mm2 clusters. We noticed that running the very same sample (stored on SGP,...
Forum: Illumina/Solexa 07-11-2013, 11:05 AM
Replies: 2
Views: 1,870
Posted By memento
MiSeq vs RNAseq

I have a technical question - why longer PE reads are not considered better for RNAseq. Since MiSeq can produce ~7-8Gbp, 25million 250 PE reads should equal 125million 50 PE reads....whats the...
Forum: Illumina/Solexa 06-10-2013, 06:51 AM
Replies: 24
Views: 8,260
Posted By memento
@ MLog When this problem arises, usually the...

@ MLog
When this problem arises, usually the flow cell is not seated properly. You have to open the flow cell compartment and re-seat the flow cell. If there was a spill all over the flow cell, You...
Forum: Illumina/Solexa 03-07-2013, 11:18 AM
Replies: 24
Views: 8,260
Posted By memento
what is more interesting. If I used i7 barcode...

what is more interesting. If I used i7 barcode (index1):
Reverse primer used to enrich:
caagcagaagacggcatacgagatCCTGCGAcggtctcggcattcctgctgaacc

Do I have to use custom index1 primer to read it...
Forum: Illumina/Solexa 03-07-2013, 09:35 AM
Replies: 24
Views: 8,260
Posted By memento
I used these primers to enrich my library: ...

I used these primers to enrich my library:
Forward:
aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttc
reverse:
caagcagaagacggcatacgagatcggtctcggcattcctgctgaacc
Forum: Illumina/Solexa 03-07-2013, 09:24 AM
Replies: 24
Views: 8,260
Posted By memento
MCS was not able to eastablish focus model as the...

MCS was not able to eastablish focus model as the result of low intensity...
they also said that PR2 is a common issue and not a real problem...
Forum: Illumina/Solexa 03-07-2013, 09:02 AM
Replies: 24
Views: 8,260
Posted By memento
Techsup asked me to run few tests. Volume test...

Techsup asked me to run few tests. Volume test failed on PR2 sipper....I guess no wonder there was nothing detected if the incorporation buffer didnt find its way to a flow cell...
looks like...
Forum: Illumina/Solexa 03-06-2013, 06:17 PM
Replies: 24
Views: 8,260
Posted By memento
kcchan, I checked the setting under sample...

kcchan,

I checked the setting under sample sheet. last 3 runs (successful!) I had a different "adapter" sequence in my sample sheet csv - would that cause that??
Forum: Illumina/Solexa 03-06-2013, 12:50 PM
Replies: 24
Views: 8,260
Posted By memento
There was big diversity of the amplicons...

There was big diversity of the amplicons sequenced (more than 300 totally different ones) plus some phix... Thanks for a quick reply!
Forum: Illumina/Solexa 03-06-2013, 12:29 PM
Replies: 24
Views: 8,260
Posted By memento
Stopped MiSeq run

Hi,
I experienced first problems with our MiSeq. This morning with new run loaded there was a flow rate error - first thought, valve.....
Did re-test at 250ul (failed) and 500ul (machine freezed)...
Forum: Bioinformatics 02-11-2013, 11:36 AM
Replies: 2
Views: 1,531
Posted By memento
Variant calling on custom amplicons with extremely high coverage

Hi,
I have a hard time obtaining variants from a bam file constructed using amplicon sequencing. When I load bam's on IGV I can see loads of reads (well, there is a limit of how much You can really...
Forum: Bioinformatics 02-08-2013, 07:49 AM
Replies: 2
Views: 1,040
Posted By memento
Split barcodes - embedded index only in forward read

Hi,
I try to split fastq file containing multiple samples (illumina paired end, miseq run). These are not general barcodes read directly on the machine - they are simply embedded within the read...
Forum: Illumina/Solexa 02-06-2013, 12:03 PM
Replies: 5
Views: 3,214
Posted By memento
so first split - then trim right ? thanks a...

so first split - then trim right ?
thanks a bunch!
Forum: Illumina/Solexa 02-06-2013, 11:38 AM
Replies: 5
Views: 3,214
Posted By memento
Demultiplexing MiSeq run reads.

Hi,
I have added indexing sequence along the regular target (at both P5 and P7, but only P5 had unique index, low plexity 20 amplicons). How to demultiplex it outside of MiSeq control ? These are...
Showing results 1 to 25 of 49

 


All times are GMT -8. The time now is 08:39 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO