SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read

Page 1 of 20 1 2311 Last »
Showing results 1 to 25 of 500
Search took 0.04 seconds. Search: Posts Made By: nucacidhunter
Forum: Illumina/Solexa 09-20-2021, 03:31 AM
Replies: 6
Views: 6,812
Posted By nucacidhunter
I is oxoadenine (oxoA).

I is oxoadenine (oxoA).
Forum: Sample Prep / Library Generation 07-09-2021, 03:25 AM
Replies: 6
Views: 3,336
Posted By nucacidhunter
Successful ligation with NEB kit requires...

Successful ligation with NEB kit requires fragment end-prep (blunting, 5'phosphorylation and 3' adenylation). SPIA uses RNA/DNA hybrid primers that will persist in at least one end of fragments and...
Forum: Sample Prep / Library Generation 07-06-2021, 02:18 AM
Replies: 6
Views: 3,336
Posted By nucacidhunter
I wonder if you could provide the exact name and...

I wonder if you could provide the exact name and product # of Ovation kit used. Ovation RNA Amplification System V2 results in single stranded DNA that cannot be used for double stranded adapter...
Forum: Sample Prep / Library Generation 07-02-2021, 02:25 AM
Replies: 1
Views: 2,505
Posted By nucacidhunter
If you are using master mixes for workflow steps,...

If you are using master mixes for workflow steps, the issue could be with position variability of thermocycler.
Forum: Sample Prep / Library Generation 07-02-2021, 02:15 AM
Replies: 6
Views: 3,336
Posted By nucacidhunter
NEB adapters are short hairpins so you may not...

NEB adapters are short hairpins so you may not see a shift in size, better to check it after PCR. Without PCR step qPCR will not work as they are not full length adapters and lack qPCR primer binding...
Forum: Illumina/Solexa 07-02-2021, 01:39 AM
Replies: 2
Views: 2,543
Posted By nucacidhunter
It is most likely sequencing cartridge related....

It is most likely sequencing cartridge related. If you have images of cycles, you can compare index 2 cycle images with index 1 images.

Illumina would replace sequencing kit.
Forum: Sample Prep / Library Generation 06-30-2021, 04:43 PM
Replies: 7
Views: 3,209
Posted By nucacidhunter
It all depends on the mRNA content of nuclei...

It all depends on the mRNA content of nuclei influenced by many factors. I normally judge by the cDNA profile and look for lack of amplification artefacts and cDNA length distribution rather than...
Forum: Sample Prep / Library Generation 06-30-2021, 02:43 AM
Replies: 7
Views: 3,209
Posted By nucacidhunter
Profile looks good and can proceed to library...

Profile looks good and can proceed to library prep according to 10x protocol.
Forum: Sample Prep / Library Generation 06-28-2021, 03:52 PM
Replies: 7
Views: 3,209
Posted By nucacidhunter
I can comment if you could post cDNA TapeSation...

I can comment if you could post cDNA TapeSation or Bioanalyser trace and also the PCR cycles used for cDNA amplification.

If you aimed to capture 10,000 cells and ended up with 100 cells the issue...
Forum: Sample Prep / Library Generation 06-28-2021, 02:13 AM
Replies: 3
Views: 2,497
Posted By nucacidhunter
It can be done and dilution factor depends on the...

It can be done and dilution factor depends on the quantity of input DNA (if using purified DNA) for up to 3 ng input BLT can be safely diluted 40x. Add water to make up for reduced BLT volume. There...
Forum: Sample Prep / Library Generation 06-28-2021, 02:05 AM
Replies: 2
Views: 2,303
Posted By nucacidhunter
There are several brands of normalization beads...

There are several brands of normalization beads as alternative. I like product from Aline Biosciences https://alinebiosciences.com/product/dna-normalizer-v3/.
Forum: Sample Prep / Library Generation 06-28-2021, 01:26 AM
Replies: 7
Views: 3,209
Posted By nucacidhunter
I have not seen that low but it depends on...

I have not seen that low but it depends on starting tissue and cDNA yield should be looked at along the fragment length distribution.
Forum: Illumina/Solexa 06-10-2021, 02:39 AM
Replies: 1
Views: 2,379
Posted By nucacidhunter
In BaseSpace click on the run and then click on...

In BaseSpace click on the run and then click on CHARTS. You can see the number of base called cycled and some charts that can be set to display several run metrics.
Forum: Sample Prep / Library Generation 10-06-2020, 04:39 PM
Replies: 3
Views: 2,501
Posted By nucacidhunter
If you add a PCR handle to 5’ end of probe and...

If you add a PCR handle to 5’ end of probe and then amplify captured target with P5 or P7 primer and the handle primer followed by nested primer containing the other adapter sequences, there will be...
Forum: Illumina/Solexa 10-06-2020, 03:03 AM
Replies: 3
Views: 1,776
Posted By nucacidhunter
There is no drawbacks but pooling 12 libraries in...

There is no drawbacks but pooling 12 libraries in one lane of S4 flow cell will output around 200M reads/library. If you are aiming for 30M reads/libray then SP flow cell (350-400M reads) will be...
Forum: Sample Prep / Library Generation 10-05-2020, 03:19 PM
Replies: 3
Views: 2,501
Posted By nucacidhunter
It would be more cost effective to add adapter...

It would be more cost effective to add adapter sequences to the nested primer for sequencing on cheapest Illumina flow cell.
Forum: Illumina/Solexa 10-05-2020, 03:10 PM
Replies: 3
Views: 1,776
Posted By nucacidhunter
There is no limit on number of libraries (up to...

There is no limit on number of libraries (up to 384 is supported by Illumina) for pooling except that they should have unique index for post-sequencing demultiplexing.

One lane of S4 flow cell...
Forum: Sample Prep / Library Generation 09-16-2020, 12:58 AM
Replies: 5
Views: 2,746
Posted By nucacidhunter
Any of following are compatible with cell(s)...

Any of following are compatible with cell(s) input with no RNA extraction:

SMART-Seq v4 3’ DE Kit (requires less sequencing)
SMART-Seq® v4 PLUS Kit
NEBNext Single Cell/Low Input RNA Library Prep...
Forum: Bioinformatics 08-21-2020, 07:51 PM
Replies: 2
Views: 1,501
Posted By nucacidhunter
There is no technical constraint on the length of...

There is no technical constraint on the length of Illumina paired-end reads apart from R1 which should be 25 cycles. In some applications using asymmetric read length is more cost effective. For...
Forum: Sample Prep / Library Generation 04-17-2020, 12:23 AM
Replies: 7
Views: 4,538
Posted By nucacidhunter
Illumina kit is gold standard in this application...

Illumina kit is gold standard in this application if RNA quantity is not limiting. On the other hand performance of Qiagen kit varies and I would suggest to trial it before committing to use it.
Forum: Sample Prep / Library Generation 03-22-2020, 02:45 AM
Replies: 12
Views: 5,967
Posted By nucacidhunter
High variability of concentration could be one...

High variability of concentration could be one reason.

To reduce variability:
1- Quantify 1st PCR amplicons and use the same mass for indexing PCR. This will reduce gel invisible artefacts.

2-...
Forum: Illumina/Solexa 11-06-2019, 01:30 PM
Replies: 19
Views: 4,761
Posted By nucacidhunter
Run stats seems within specs for the library type...

Run stats seems within specs for the library type although they seem to be more cautious. To increase output safely following can be done:
1- Increasing cluster density to around 800k/mm2
2-...
Forum: Illumina/Solexa 11-05-2019, 01:55 AM
Replies: 19
Views: 4,761
Posted By nucacidhunter
More info for following would be useful: 1- Are...

More info for following would be useful:
1- Are the libraries 6S V regions and overall prep workflow
2- cluster density
3- How many libraries are multiplexed
4- Read output
Forum: Illumina/Solexa 10-29-2019, 03:22 AM
Replies: 7
Views: 4,677
Posted By nucacidhunter
It should be TruSeq as FastQC would indicate. I...

It should be TruSeq as FastQC would indicate. I am not sure but you can try following:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA


Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Forum: Illumina/Solexa 10-28-2019, 11:57 PM
Replies: 7
Views: 4,677
Posted By nucacidhunter
The library is sequenced on Illumina system so...

The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.
Showing results 1 to 25 of 500
Page 1 of 20 1 2311 Last »

 

All times are GMT -8. The time now is 09:43 AM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO