SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 20 1 2311 Last »
Showing results 1 to 25 of 500
Search took 0.04 seconds. Search: Posts Made By: pmiguel
Forum: Sample Prep / Library Generation 02-06-2020, 09:52 AM
Replies: 21
Views: 8,270
Posted By pmiguel
Interesting. Appears to use a...

Interesting. Appears to use a strand-denaturation/hybridization-based normalization to remove/reduce concentrations of highly represented cDNAs. That is, enzymatic digestion of DNA/RNA duplexes that...
Forum: Sample Prep / Library Generation 12-22-2019, 10:49 AM
Replies: 20
Views: 14,350
Posted By pmiguel
Glad to help... -- Phillip

Glad to help...
--
Phillip
Forum: Bioinformatics 10-11-2019, 08:25 AM
Replies: 3
Views: 1,270
Posted By pmiguel
Don't you mean: for file in *.fastq.sam.bam ...

Don't you mean:

for file in *.fastq.sam.bam
do
mv $file ${file%.fastq.sam.bam}.txt
done

--
Phillip
Forum: Illumina/Solexa 09-30-2019, 06:34 AM
Replies: 2
Views: 1,571
Posted By pmiguel
[Note added after writing post: this exact same...

[Note added after writing post: this exact same question, using the same wording was posted previously:

http://seqanswers.com/forums/showthread.php?t=86749

Why?]

Right, you just put the...
Forum: Sample Prep / Library Generation 06-21-2019, 07:44 AM
Replies: 5
Views: 3,612
Posted By pmiguel
Old school method involved embedding cells in...

Old school method involved embedding cells in agarose and lysing/prepping the DNA in situ. Initially these were just little slabs of agarose. But later moved more to higher surface area collects of...
Forum: Bioinformatics 06-12-2019, 12:43 PM
Replies: 2
Views: 1,089
Posted By pmiguel
Looks more-or-less random to me. How many...

Looks more-or-less random to me. How many standard deviations from the mean number of hits/repeat are the high and low-hit repeat counts?

--
Phillip
Forum: Illumina/Solexa 05-07-2019, 01:01 PM
Replies: 2
Views: 1,634
Posted By pmiguel
Best method to add custom primer to MiSeq Illumina sequencing primers?

What pipette is recommended (or have you seen used) to pipette custom primer into the Illumina sequencing primer wells of a MiSeq? (See here...
Forum: Illumina/Solexa 04-18-2019, 09:35 AM
Replies: 1
Views: 1,192
Posted By pmiguel
Differential amplicon size effects on clustering across Illumina instruments

I would like to recommend to your attention a Bioarchive (pre-print) paper:

https://doi.org/10.1101/388108

entitled:
Measuring Illumina Size Bias Using REcount: A Novel Method for Highly...
Forum: Illumina/Solexa 03-25-2019, 08:56 AM
Replies: 1
Views: 780
Posted By pmiguel
The answer is: The sequence: ...

The answer is:

The sequence:
Oligonucleotide sequences©2017 Illumina,Inc. All rights reserved.

AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGTCCGA

is just the PCR primer and doesn't contain the...
Forum: Illumina/Solexa 03-22-2019, 09:10 AM
Replies: 1
Views: 780
Posted By pmiguel
Small RNA adapters skip first 5 bases of R1?

I've now seen a couple of sets of libraries with Illumina "small RNA" adapters that seem to somehow "skip" the first 5 bases of R1. This being being obvious only when comparing the forward and...
Forum: Illumina/Solexa 03-07-2019, 11:40 AM
Replies: 5
Views: 2,482
Posted By pmiguel
Seems like this recent change is more of a...

Seems like this recent change is more of a reversion to the original Illumina plan types. With a very low level coverage for people who pretty much do their own repairs (bronze) and the more standard...
Forum: Bioinformatics 03-01-2019, 07:21 AM
Replies: 4
Views: 1,329
Posted By pmiguel
"You have recently started working in a lab and...

"You have recently started working in a lab and have been assigned the following task:"

That was the first sentence of your homework question (or take home exam), right?

--
Phillip
Forum: Bioinformatics 03-01-2019, 03:53 AM
Replies: 4
Views: 1,329
Posted By pmiguel
Upon being given such a homework assignment, I...

Upon being given such a homework assignment, I would post it on appropriate web forums hoping to find someone gullible enough to save me from answering the question myself.

Wait, no! I would not...
Forum: Illumina/Solexa 01-17-2019, 01:04 PM
Replies: 1
Views: 961
Posted By pmiguel
First, we should legally sanctify this thread: ...

First, we should legally sanctify this thread:



What you would want to add on to the outside of your primers would be:

Index1 side
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Index2 side
Forum: 454 Pyrosequencing 01-14-2019, 09:13 AM
Replies: 5
Views: 18,426
Posted By pmiguel
I wouldn't go that far! Cheap (no-agarose-gel)...

I wouldn't go that far! Cheap (no-agarose-gel) Illumina mate-pair libraries are still legitimate, if trailing-edge, technologies.

454 is *dead*, dead.

--
Phillip
Forum: 454 Pyrosequencing 01-14-2019, 08:06 AM
Replies: 5
Views: 18,426
Posted By pmiguel
See the OP. The 454 is obsolete. Reagents no...

See the OP. The 454 is obsolete. Reagents no longer available to run the instrument. Hard to get less "beginner friendly" than "dead".

--
Phillip
Forum: Illumina/Solexa 12-20-2018, 12:40 PM
Replies: 9
Views: 3,282
Posted By pmiguel
You are running non-UDI indexes on the NovaSeq?...

You are running non-UDI indexes on the NovaSeq? Are you not concerned about index swapping?

We demultiplex allowing 0 mismatches for all Illumina runs these days. So I haven't taken note of...
Forum: Illumina/Solexa 12-03-2018, 03:49 AM
Replies: 6
Views: 7,343
Posted By pmiguel
Impossible to guess what "much less" means in...

Impossible to guess what "much less" means in this context. The previous poster mentioned 100x less -- that is clearly an issue.

Anyway, you will want to contact Illumina technical support. That...
Forum: Illumina/Solexa 11-30-2018, 04:30 AM
Replies: 3
Views: 2,290
Posted By pmiguel
No reason why it would not be possible. Since you...

No reason why it would not be possible. Since you don't specify an organism, I presume you mean a mammal. So you want an average of 3 billion bases/sample. So that would be 1000 UDIs. Presuming you...
Forum: Sample Prep / Library Generation 11-26-2018, 07:40 AM
Replies: 4
Views: 1,304
Posted By pmiguel
Yes, please everyone switch to blue light...

Yes, please everyone switch to blue light illumination for preparative gels! We did so > 20 years ago. I'm just realizing that many labs (and new PI!) are unaware of the problems UV light damage to...
Forum: Illumina/Solexa 11-06-2018, 07:22 AM
Replies: 8
Views: 3,981
Posted By pmiguel
SAV 2.4.5 includes an "occupied count" and "%...

SAV 2.4.5 includes an "occupied count" and "% occupied" metric in the drop down list of the Flow Cell Chart pane of the Analysis tab.

--
Phillip
Forum: Illumina/Solexa 11-01-2018, 10:07 AM
Replies: 8
Views: 3,981
Posted By pmiguel
The new version of SAV has a metric "% occupancy"...

The new version of SAV has a metric "% occupancy" for each tile. You should check that.
It looks like you either had very low occupancy (very under-clustered) or very massive over-clustering....
Forum: Sample Prep / Library Generation 10-31-2018, 12:10 PM
Replies: 1
Views: 1,765
Posted By pmiguel
No, but if you post your spectrum here, one of ...

No, but if you post your spectrum here, one of us might recognize it.

--
Phillip
Forum: Sample Prep / Library Generation 10-31-2018, 06:56 AM
Replies: 17
Views: 11,593
Posted By pmiguel
You would probably need to sequence it to find...

You would probably need to sequence it to find out what it is. But my guess would be lots of tRNA, or some other small RNA. Or something unexpected.

Since the rRNA peaks appear to be intact, it...
Forum: Sample Prep / Library Generation 10-31-2018, 04:08 AM
Replies: 17
Views: 11,593
Posted By pmiguel
Most likely it is a mixture of small RNAs -- 5S,...

Most likely it is a mixture of small RNAs -- 5S, tRNA, etc. "TRIfast" I have not heard of, but I presume it is another version of "Trizol", the commercial acid phenol reagents. For whatever reason,...
Showing results 1 to 25 of 500
Page 1 of 20 1 2311 Last »

 


All times are GMT -8. The time now is 04:18 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO