Forum: Sample Prep / Library Generation
02-06-2020, 09:52 AM
|
Replies: 21
Views: 8,248
Interesting. Appears to use a...
Interesting. Appears to use a strand-denaturation/hybridization-based normalization to remove/reduce concentrations of highly represented cDNAs. That is, enzymatic digestion of DNA/RNA duplexes that...
|
Forum: Sample Prep / Library Generation
12-22-2019, 10:49 AM
|
Replies: 20
Views: 14,333
|
Forum: Bioinformatics
10-11-2019, 08:25 AM
|
Replies: 3
Views: 1,266
|
Forum: Illumina/Solexa
09-30-2019, 06:34 AM
|
Replies: 2
Views: 1,566
|
Forum: Sample Prep / Library Generation
06-21-2019, 07:44 AM
|
Replies: 5
Views: 3,602
Old school method involved embedding cells in...
Old school method involved embedding cells in agarose and lysing/prepping the DNA in situ. Initially these were just little slabs of agarose. But later moved more to higher surface area collects of...
|
Forum: Bioinformatics
06-12-2019, 12:43 PM
|
Replies: 2
Views: 1,083
|
Forum: Illumina/Solexa
05-07-2019, 01:01 PM
|
Replies: 2
Views: 1,629
|
Forum: Illumina/Solexa
04-18-2019, 09:35 AM
|
Replies: 1
Views: 1,188
|
Forum: Illumina/Solexa
03-25-2019, 08:56 AM
|
Replies: 1
Views: 780
The answer is:
The sequence: ...
The answer is:
The sequence:
Oligonucleotide sequences©2017 Illumina,Inc. All rights reserved.
AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGTCCGA
is just the PCR primer and doesn't contain the...
|
Forum: Illumina/Solexa
03-22-2019, 09:10 AM
|
Replies: 1
Views: 780
Small RNA adapters skip first 5 bases of R1?
I've now seen a couple of sets of libraries with Illumina "small RNA" adapters that seem to somehow "skip" the first 5 bases of R1. This being being obvious only when comparing the forward and...
|
Forum: Illumina/Solexa
03-07-2019, 11:40 AM
|
Replies: 5
Views: 2,475
Seems like this recent change is more of a...
Seems like this recent change is more of a reversion to the original Illumina plan types. With a very low level coverage for people who pretty much do their own repairs (bronze) and the more standard...
|
Forum: Bioinformatics
03-01-2019, 07:21 AM
|
Replies: 4
Views: 1,325
|
Forum: Bioinformatics
03-01-2019, 03:53 AM
|
Replies: 4
Views: 1,325
Upon being given such a homework assignment, I...
Upon being given such a homework assignment, I would post it on appropriate web forums hoping to find someone gullible enough to save me from answering the question myself.
Wait, no! I would not...
|
Forum: Illumina/Solexa
01-17-2019, 01:04 PM
|
Replies: 1
Views: 955
|
Forum: 454 Pyrosequencing
01-14-2019, 09:13 AM
|
Replies: 5
Views: 18,391
|
Forum: 454 Pyrosequencing
01-14-2019, 08:06 AM
|
Replies: 5
Views: 18,391
|
Forum: Illumina/Solexa
12-20-2018, 12:40 PM
|
Replies: 9
Views: 3,279
|
Forum: Illumina/Solexa
12-03-2018, 03:49 AM
|
Replies: 6
Views: 7,331
Impossible to guess what "much less" means in...
Impossible to guess what "much less" means in this context. The previous poster mentioned 100x less -- that is clearly an issue.
Anyway, you will want to contact Illumina technical support. That...
|
Forum: Illumina/Solexa
11-30-2018, 04:30 AM
|
Replies: 3
Views: 2,280
|
Forum: Sample Prep / Library Generation
11-26-2018, 07:40 AM
|
Replies: 4
Views: 1,301
Yes, please everyone switch to blue light...
Yes, please everyone switch to blue light illumination for preparative gels! We did so > 20 years ago. I'm just realizing that many labs (and new PI!) are unaware of the problems UV light damage to...
|
Forum: Illumina/Solexa
11-06-2018, 07:22 AM
|
Replies: 8
Views: 3,967
|
Forum: Illumina/Solexa
11-01-2018, 10:07 AM
|
Replies: 8
Views: 3,967
|
Forum: Sample Prep / Library Generation
10-31-2018, 12:10 PM
|
Replies: 1
Views: 1,760
|
Forum: Sample Prep / Library Generation
10-31-2018, 06:56 AM
|
Replies: 17
Views: 11,573
You would probably need to sequence it to find...
You would probably need to sequence it to find out what it is. But my guess would be lots of tRNA, or some other small RNA. Or something unexpected.
Since the rRNA peaks appear to be intact, it...
|
Forum: Sample Prep / Library Generation
10-31-2018, 04:08 AM
|
Replies: 17
Views: 11,573
|