SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 20 of 20
Search took 0.00 seconds.
Search: Posts Made By: Sergio.pv
Forum: Bioinformatics 11-08-2017, 06:22 AM
Replies: 0
Views: 1,159
Posted By Sergio.pv
False variant calls due to alignment (Allele specific expression, aka ASE)

Dear Community
I am trying to identify genes having allele specific expression from RNAseq data using GATK's ASEReadCaller and MBASED...
Forum: Bioinformatics 04-02-2014, 06:52 AM
Replies: 1
Views: 1,144
Posted By Sergio.pv
fastq_quality_filter -p 100 or could be less?

Hello everyone,
I am using FASTX-toolkit to filter my data (small RNA fraction for miRNA analyses) according to quality.
I use the following settings:
fastq_quality_filter -v -q 17 -p 100 -Q 33
...
Forum: Bioinformatics 02-19-2014, 08:52 AM
Replies: 3
Views: 1,099
Posted By Sergio.pv
Hi GenoMax, thank you for the quick reply. I...

Hi GenoMax,
thank you for the quick reply.
I work with cattle and I would like to do counts analysis.
Forum: Bioinformatics 02-19-2014, 07:47 AM
Replies: 3
Views: 1,099
Posted By Sergio.pv
Is 30000 reads too low for mapping (miRNAs)

Hello community,
I have just received a fastq file of a study i am conducting.
It had an overall poor quality, and after filetering reads according to quality and size (minQV=17, min length=16),...
Forum: Bioinformatics 11-22-2013, 02:45 AM
Replies: 2
Views: 1,564
Posted By Sergio.pv
Ok, to make it work i converted U into T and it...

Ok, to make it work i converted U into T and it worked.
if it is any use, with fastx tool kit:

fasta_nucleotide_changer -v -i bta-stem-loops.mirbase20.fa -o bta-stemloops.fa -d
Forum: Bioinformatics 11-22-2013, 02:41 AM
Replies: 4
Views: 1,641
Posted By Sergio.pv
if it is usefull, here the complete script to...

if it is usefull, here the complete script to remove the headers ('@') and then count repeated terms in column 3 of the SAM file:

grep -v '@' myfile.out | awk '{print$3}' | sort | uniq -c | sort...
Forum: Bioinformatics 11-22-2013, 02:28 AM
Replies: 4
Views: 1,641
Posted By Sergio.pv
thanks, the grep function was very usufull to...

thanks, the grep function was very usufull to remove the headers.
After doing that, i did a count ot he repited elements on column 3.
cat myfile-noheaders.out | awk '{print$3}' | sort | uniq -c |...
Forum: Bioinformatics 11-21-2013, 10:35 AM
Replies: 4
Views: 1,641
Posted By Sergio.pv
script suggestion (SAM file)

Hi everyone!
In this attached example, i would like to know how many times the element
"bta-miR-191" and "bta-miR-10" in the header of a SAM file is repeated in the rest of
the document (in this...
Forum: Bioinformatics 11-21-2013, 07:16 AM
Replies: 2
Views: 1,564
Posted By Sergio.pv
I did the following, as a test: first, i use...

I did the following, as a test:
first, i use the above metioned sequences (identical as you can see)
>bta-let-7b MIMAT0004331
UGAGGUAGUAGGUUGUGUGGUU
>dummy
UGAGGUAGUAGGUUGUGUGGUU

gmapper-ls...
Forum: Bioinformatics 11-21-2013, 05:55 AM
Replies: 2
Views: 1,564
Posted By Sergio.pv
puzzle with gmapper -M mirna (shrimp)

Hi everyone,
i am mapping short reads from ion torrent PGM. Reads are QV~20 and 16-155 length.
In FastQC appears this as the highest represented read:
TGAGGTAGTAGGTTGTGTGGTT 19528counts
...
Forum: Bioinformatics 11-19-2013, 01:53 PM
Replies: 6
Views: 2,918
Posted By Sergio.pv
yes you are right. My attempt is to analize...

yes you are right.
My attempt is to analize data from the <200 nt RNA fraction, to find the most expressed miRNA candidates.

Best!
Forum: Bioinformatics 11-19-2013, 12:47 PM
Replies: 6
Views: 2,918
Posted By Sergio.pv
As suggested by the ion torrent's technical note,...

As suggested by the ion torrent's technical note, this would leave little or no adapter sequence in the reads.
I have attached the mentioned note.
Forum: Bioinformatics 11-19-2013, 12:25 PM
Replies: 6
Views: 2,918
Posted By Sergio.pv
Yes, that was I. I am really stuck with this...

Yes, that was I.
I am really stuck with this problem, so i postd it in both sites.

Best!
Forum: Bioinformatics 11-19-2013, 11:44 AM
Replies: 6
Views: 2,918
Posted By Sergio.pv
min length and max length with fastx tookit

Hello everyone,
i was wondering if there's a way to filter fastq reads based on minimun and maximun length. Plus trimming at minimun quality value.

this is the closest i've came out with:
...
Forum: Bioinformatics 11-19-2013, 02:11 AM
Replies: 8
Views: 4,818
Posted By Sergio.pv
Thanks Simon!

Thanks Simon!
Forum: Ion Torrent 11-19-2013, 02:04 AM
Replies: 2
Views: 3,347
Posted By Sergio.pv
P1 and A adater trimming and mapping

Hi eveyone,
i have a few very basic questions that are buging me:
- The emulsion PCR performed to create a template results in amplicons attached to a bed, which in turn goes to the pico-well and...
Forum: Bioinformatics 11-19-2013, 01:36 AM
Replies: 8
Views: 4,818
Posted By Sergio.pv
Thank you very much to you all for the quick...

Thank you very much to you all for the quick responses, it's now clearer.

If I understood correctly, the analyses performed by FastQC are modeled for genomic DNA, where the sequenced fragments...
Forum: Bioinformatics 11-18-2013, 07:38 AM
Replies: 8
Views: 4,818
Posted By Sergio.pv
FastQC Overrepresented Sequences problem

Hi guys,
i am very new at NGS data procesing.
First, a small introduction to my current situation:
- Samples were the small RNA fraction (<200 nt, MIRVANA MIRNA ISOLATION kit).
- Library and...
Forum: Introductions 11-18-2013, 07:13 AM
Replies: 0
Views: 873
Posted By Sergio.pv
Hi guys!

Hi everyone, i have recently started working with NGS data and it's something i am not so familiar with. So i will ray to share the few things i know with you, and hopefully you'll do the same.
...
Forum: Introductions 07-08-2013, 06:19 AM
Replies: 0
Views: 602
Posted By Sergio.pv
Hi everyone

Hi everyone, I am doing my PhD and I am starting with deep sequencing analysis using PGM ion torrent. I joined this community to get help for my analysis and maybe later help other with theirs.
...
Showing results 1 to 20 of 20

 


All times are GMT -8. The time now is 09:01 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO