SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 24 of 24
Search took 0.00 seconds.
Search: Posts Made By: mhadidi2002
Forum: Bioinformatics 10-28-2014, 05:59 AM
Replies: 6
Views: 1,797
Posted By mhadidi2002
I am using my custom pipeline. so you mean that...

I am using my custom pipeline. so you mean that if I used mothur pipeline, they keep this in consideration to the rest of pipeline, but if I am using my pipeline I have to write a script that do...
Forum: Bioinformatics 10-28-2014, 05:52 AM
Replies: 6
Views: 1,797
Posted By mhadidi2002
Fastx has a tool called fastq_collaper which...

Fastx has a tool called fastq_collaper which output a fasta file like this:

>1-934
CCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGGAAGCCTGAA
>2-915
CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT
...
Forum: Bioinformatics 10-28-2014, 05:30 AM
Replies: 6
Views: 1,797
Posted By mhadidi2002
Thanks Kmcarr for the reply. I am asking because...

Thanks Kmcarr for the reply. I am asking because in mothur pipeline they do remove duplicates, that's why I am confused. Do you know why they are doing such so?
if you go to the link:...
Forum: Bioinformatics 10-28-2014, 04:09 AM
Replies: 6
Views: 1,797
Posted By mhadidi2002
Removing duplicates from 16S RNA data

Hello All,

I would like to start a pipeline to analyse 16S RNA data, however I am not sure weather to include the step of removing duplicates or not. The aim of metagenomics is to compare...
Forum: Bioinformatics 04-07-2014, 06:23 AM
Replies: 2
Views: 1,539
Posted By mhadidi2002
Prokaryotic gene prediction from Contigs

Dear All,

I have a multi-fasta file of millions of contigs of bacteria which I would like to run gene prediction on it. Which program do you recommend. I would like to get the output in fasta...
Forum: Bioinformatics 10-10-2013, 06:50 AM
Replies: 0
Views: 1,254
Posted By mhadidi2002
Bacterial genes database download

Hello All,

I have one question which may be basic to some of you, anyways I would like to download nucleotide sequences for all genes of Bacteria Kingdom (or its GI list, so I can filter nr/nt...
Forum: Bioinformatics 05-07-2013, 03:56 AM
Replies: 1
Views: 2,577
Posted By mhadidi2002
BLAST best hit?

Hello,

I would like to ask about the standalone BLAST output best hit. Is it the first match for a given query sequence is always the best hit? As long as I know, it is sorted based on the...
Forum: Bioinformatics 06-01-2012, 10:39 AM
Replies: 6
Views: 5,456
Posted By mhadidi2002
TRINITY:Input (Fastq) and Output files (GFF)

Dear All,

I am a new user for Trinity. I have 3 fastq files (2 paied end + 1 single end), From the documentation, it is writen that It can accept either single ends (--single). or pair ends...
Forum: Bioinformatics 05-28-2012, 03:02 PM
Replies: 0
Views: 1,140
Posted By mhadidi2002
Cuffcompare *.refmap results

Hello,

I used cuffcompare to compare a reference GFF file with another cufflinks GFF file. When I looked at the *refmap file, there are 2 possibilities in the third column, = or c. according to...
Forum: De novo discovery 05-16-2012, 01:29 PM
Replies: 0
Views: 1,110
Posted By mhadidi2002
From RNA-seq reads / alignments to GFF files

Hello,

Does any one know how can I create gene models (GFF files) from RNA-seq reads or alignments ?

Inputs: RNA-seq reads and reference genome, I also have the bam mapping file produced from...
Forum: Bioinformatics 03-12-2012, 02:52 PM
Replies: 1
Views: 4,635
Posted By mhadidi2002
viewing bed files into IGV

Hello,

I need to ask, does anyone know how to view bed file using IGV?

my file is like that:
#chrom chromStart chromEnd
chr21 9434178 9434609
chr21 9434178 9434609
chr21 9508110 9508214...
Forum: Bioinformatics 03-06-2012, 01:42 PM
Replies: 1
Views: 1,473
Posted By mhadidi2002
ORF from Multifasta File

Hello,

I need to ask about any program that takes multifasta file, and gives th ORF for each sequence in one file.

Thanks,
Forum: Bioinformatics 03-06-2012, 05:03 AM
Replies: 0
Views: 1,304
Posted By mhadidi2002
amino acid sequence from GTF file

What is the best way to get amino acid sequence from GTF file, provided that I have the genome?
Best way = easiest + fastest

Thanks,
Forum: Bioinformatics 03-01-2012, 02:42 PM
Replies: 1
Views: 1,755
Posted By mhadidi2002
Transcriptome Reannotation Pipeline based on RNA-Seq..

Hello All,

I would like to share my ideas with you, and ask for you suggestions..

Thanks to Transcriptome reconstruction programs like Cufflinks and Scripture, and provided that we have RNA Seq...
Forum: Bioinformatics 02-24-2012, 03:01 PM
Replies: 1
Views: 1,703
Posted By mhadidi2002
Scripture Java Exception

Hello,

I have used scripture to do the segmentation task.

The command:

scripture$ java -jar scripture-beta2.jar -alignment lyco.sam -out lyc_scrip.txt -sizeFile spe.sizes.txt -chr...
Forum: Bioinformatics 02-17-2012, 02:03 AM
Replies: 1
Views: 2,975
Posted By mhadidi2002
From bam to wig format

Hello,

I have bam files and I need to convert it to wig format to be like this:

variableStep chrom=chr2
300701 12.5
300702 12.5
300703 12.5
300704 12.5
300705 12.5
Forum: Bioinformatics 02-07-2012, 07:10 AM
Replies: 4
Views: 6,037
Posted By mhadidi2002
Hello Thanks for the reply.. I typed the...

Hello

Thanks for the reply..
I typed the following command:
makeblastdb -in good_proteins.fasta -dbtype prot -out my_prot_blast_db

But I can't find the output. can u please how can I retrieve...
Forum: Bioinformatics 02-06-2012, 08:00 AM
Replies: 4
Views: 6,037
Posted By mhadidi2002
All agains All BLAST

Hello,

I need a tool that can blast proteins sequences in a multifasta file against each other. I mean if there are 10 proteins, I need to blast each one of the ten with the other 9, and reports...
Forum: Bioinformatics 02-01-2012, 07:21 AM
Replies: 10
Views: 3,742
Posted By mhadidi2002
Hello Chadn737, My work is similar to yours....

Hello Chadn737,

My work is similar to yours. I have 4 species for the same plant, their genomes aren't sequenced, but there is a sequence for 1 closely related plant, which is considered as the...
Forum: Bioinformatics 02-01-2012, 12:32 AM
Replies: 10
Views: 3,742
Posted By mhadidi2002
Simon, thanks for joining the conversation. ...

Simon, thanks for joining the conversation.

the main aim is to find differences among 4 species, each one has its own RNA reads aligned to the genome. these 4 species suffer different stress, I...
Forum: Bioinformatics 01-31-2012, 11:57 PM
Replies: 10
Views: 3,742
Posted By mhadidi2002
Hi jjohnson, Thanks for the reply. can...

Hi jjohnson,

Thanks for the reply.
can these software give annotation to aligned reads? The information that I need is ORFs, SNPs, splice varients, ..etc

Thanks again :)
Forum: Bioinformatics 01-31-2012, 11:47 PM
Replies: 10
Views: 3,742
Posted By mhadidi2002
Thanks Dpryan for the reply.. Actually I have...

Thanks Dpryan for the reply..
Actually I have the reads already aligned, I need to add annotations to the aligned reads that will include: ORFs, splice variants, SNPs,... and how these all will...
Forum: Bioinformatics 01-31-2012, 06:30 AM
Replies: 10
Views: 3,742
Posted By mhadidi2002
RNA-Seq annotation

Hello,

I need to know is there any software that can take input of Reference genome and RNA-Seq reads and output genomic annotation from these RNA reads?

Thanks
Forum: Bioinformatics 06-03-2011, 01:17 AM
Replies: 0
Views: 1,186
Posted By mhadidi2002
Chip Seq peaks detection using SAM files

Hello,

This is my first post in this community!
I am a beginner data analyst.

I have SAM files generated from chip seq experiment. I want detect peaks sam files, so which tools can I use.
...
Showing results 1 to 24 of 24

 


All times are GMT -8. The time now is 07:26 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO