SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 48
Search took 0.00 seconds.
Search: Posts Made By: zinky
Forum: Bioinformatics 06-17-2016, 05:03 AM
Replies: 24
Views: 8,476
Posted By zinky
well. excelent work. i can see many novel modules...

well. excelent work. i can see many novel modules added in your published version. I like this tool:D
Forum: Bioinformatics 12-09-2015, 12:34 AM
Replies: 24
Views: 8,476
Posted By zinky
Hi Phil, Thanks for your quick reply; Well , your...

Hi Phil, Thanks for your quick reply; Well , your suggestion is a good choice for me; Technically, parsing output of those tools to generated summary report is a lightweight job, and it therefore...
Forum: Bioinformatics 12-09-2015, 12:03 AM
Replies: 24
Views: 8,476
Posted By zinky
Hi ewels, i run MultiQC on my 6 tophat output...

Hi ewels, i run MultiQC on my 6 tophat output folders. i found all log files were parsed and it also gives a bowtie2 plot. So dose MultiQC check the log files fisrst then parsed keywords like...
Forum: Bioinformatics 12-08-2015, 11:20 PM
Replies: 24
Views: 8,476
Posted By zinky
nice job, i starred already

nice job, i starred already
Forum: Bioinformatics 03-11-2015, 06:34 PM
Replies: 7
Views: 1,925
Posted By zinky
yes, FoldChange is taken in consideration mainly....

yes, FoldChange is taken in consideration mainly. I also performed a test which was proposed by Audic S et al in 1997(ref:Audic S, Claverie JM. The significance of digital gene expression profiles....
Forum: Bioinformatics 03-10-2015, 08:51 PM
Replies: 7
Views: 1,925
Posted By zinky
hi amitm, i have no replicates but only two...

hi amitm, i have no replicates but only two samples here. I know the way to detect DE features while my purpose is to demonstrate that there is no difference between them. You advice is useful for...
Forum: Bioinformatics 03-08-2015, 10:41 PM
Replies: 6
Views: 1,334
Posted By zinky
Smile I don't know the reference used in your tophat...

I don't know the reference used in your tophat mapping procedure, gene level or chromosome level. If chromosome level, you may also need a gene annotation file with .gff suffixed. Then the...
Forum: Bioinformatics 03-08-2015, 05:51 PM
Replies: 7
Views: 1,925
Posted By zinky
thanks for your suggestion. yes i mean relative...

thanks for your suggestion. yes i mean relative transcripts level, because the library size may result in differ counts number( PS: there are alseo some other variables). After normalization, my...
Forum: Bioinformatics 03-07-2015, 12:35 AM
Replies: 7
Views: 1,925
Posted By zinky
How to decide the two sample are the same in trancription level?

Hi, guys.
Is there any criterion to help us to draw a conclusion that two samples are the same or unchanged in trancription level based on RNA-seq data? Correlation test ? or No differential gene...
Forum: Bioinformatics 11-05-2014, 06:39 PM
Replies: 4
Views: 1,330
Posted By zinky
thanks for your suggestion,I have asked the...

thanks for your suggestion,I have asked the sequence stuff and got insert size information : 350bp .so my parameter -a was set 600 to tolerate extra larger insert size aiming improve mapping rate....
Forum: Bioinformatics 11-05-2014, 05:59 PM
Replies: 4
Views: 1,330
Posted By zinky
I use NGS QC Toolkit to do QC, and the result...

I use NGS QC Toolkit to do QC, and the result shows that more than 80% of reads are high quality filtered reads. So I do the mapping step. My mapping commond lines are:
bwa aln -t 5 genome.fa...
Forum: Bioinformatics 11-05-2014, 04:40 AM
Replies: 4
Views: 1,330
Posted By zinky
Question Human whole-genome sequencing data analysis with low mapping rate

Hi, everyone
I got four samples' Human WGS data few days before to identify the variants as well as CNVs. After QC and mapping steps of my analysis workflow, I found each sample's mapping rate...
Forum: Bioinformatics 01-17-2014, 03:17 AM
Replies: 9
Views: 1,571
Posted By zinky
as i know, the blast2go output dose not contains...

as i know, the blast2go output dose not contains P value of each GO term. the Pvalue mentioned above is calculated by extra test such as Fisher's exact test or hypergeometric test . you may write a...
Forum: Bioinformatics 12-18-2013, 03:48 AM
Replies: 13
Views: 10,077
Posted By zinky
i use bwa 0.7.5a to do mapping step , it seems...

i use bwa 0.7.5a to do mapping step , it seems good. however, only one of my 21 samples encounter this problem, which makes me confusing. any help message?
Forum: Bioinformatics 12-16-2013, 06:49 PM
Replies: 2
Views: 3,856
Posted By zinky
thanks a lot, i also browsed this page...

thanks a lot, i also browsed this page http://www.rna-seqblog.com/how-many-reads-are-enough/, which both makes me a little clear now.
Forum: Bioinformatics 12-16-2013, 07:07 AM
Replies: 2
Views: 3,856
Posted By zinky
Red face RNA-seq depth for lncRNA quantification

HI, guys , i have 6 human cell samples preparing for RNA-seq to do mRNA expression and lncRNA expression meta-analysis. However, i am not sure how many reads or depth are enough to my analysis.
...
Forum: Bioinformatics 05-17-2013, 07:39 PM
Replies: 12
Views: 2,444
Posted By zinky
make sure that u have done the quality controll...

make sure that u have done the quality controll step ,this pheno may result from adaptor contamination
Forum: Bioinformatics 03-29-2013, 06:39 PM
Replies: 5
Views: 2,097
Posted By zinky
it's hard to say , maybe you can draw a...

it's hard to say , maybe you can draw a saturation curve for certain kind of data by a coverage gradient. In my view, different samples have unequal meth-level, there are no standard or minimum...
Forum: Bioinformatics 02-26-2013, 11:11 PM
Replies: 3
Views: 1,053
Posted By zinky
well , I mean , I just employed cuffdiff to do...

well , I mean , I just employed cuffdiff to do reads counting as well as normalizition(fpkm , the most classic method), and of course there are replicates on my hand. DonDolowy's question is not...
Forum: Bioinformatics 02-26-2013, 05:15 PM
Replies: 3
Views: 1,053
Posted By zinky
I encountered the same proplem, for...

I encountered the same proplem, for multicondition's comparision, I first use cuffdiff to do reads counting and normalizition (with fpkm output) by --nondiff option, then extracted those expression...
Forum: Epigenetics 12-29-2012, 01:36 AM
Replies: 4
Views: 5,300
Posted By zinky
Thank you very much!

Thank you very much!
Forum: Epigenetics 12-25-2012, 06:05 PM
Replies: 4
Views: 5,300
Posted By zinky
hi, i try to use this tool to do analysis , but i...

hi, i try to use this tool to do analysis , but i find the links here cannot be openned, can u send me a copy of it as well as some illustrations ,thanks a lot! my mail: zhaoqi699@sina.com
Forum: Bioinformatics 12-20-2012, 05:38 PM
Replies: 3
Views: 1,142
Posted By zinky
o i know "." means N .......

o i know "." means N .......
Forum: Bioinformatics 12-20-2012, 05:03 PM
Replies: 3
Views: 1,142
Posted By zinky
Unhappy fastq file with "." in sequence line

hi everyone ,
my fastq file contains sequence with "." in it like:
@

TTTAA.GAATAATAAGTCTAATCCCCTTCTATTCTGTAGCACCACTTCGGACAGGGAAGTTAAAGATTCTTCTAATTTGGTTATAGACTGTTCTATAGTT
+...
Forum: Bioinformatics 12-13-2012, 03:52 AM
Replies: 6
Views: 4,393
Posted By zinky
you may try IPA ,it gives you this kind f TF...

you may try IPA ,it gives you this kind f TF which associated to your genelist.alternatively you can also gathering some TF data from open database like transfac,this way may take a lot time .
Showing results 1 to 25 of 48

 


All times are GMT -8. The time now is 10:20 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO