Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • seb567
    Senior Member
    • Jul 2008
    • 260

    #16
    Originally posted by severin View Post
    So when you say it is fixed in the developers version does that mean the read-write checkpoints will go beyond the scaffolding process?

    Thanks
    The -read-write-checkpoints does not do anything after the scaffolding in development version too.

    However, that's a feature that could be added.

    Comment

    • severin
      Genome Informatics Facility
      • Sep 2009
      • 105

      #17
      Install Error

      Originally posted by seb567 View Post
      To get the development version:

      Code:
      git clone git://github.com/sebhtml/ray.git
      git clone git://github.com/sebhtml/RayPlatform.git
      cd ray
      make
      ./Ray -version
      when I follow your suggestion with the developmental version I get the following errors

      icpc: command line warning #10159: invalid argument for option '-std'
      CXX code/plugin_KmerAcademyBuilder/Kmer.o
      icpc: command line warning #10159: invalid argument for option '-std'
      CXX code/plugin_Library/LibraryPeakFinder.o
      icpc: command line warning #10159: invalid argument for option '-std'
      CXX code/plugin_Library/LibraryWorker.o
      icpc: command line warning #10159: invalid argument for option '-std'
      CXX code/plugin_Library/Library.o
      icpc: command line warning #10159: invalid argument for option '-std'
      CXX code/plugin_MachineHelper/MachineHelper.o
      icpc: command line warning #10159: invalid argument for option '-std'
      CXX code/plugin_MessageProcessor/MessageProcessor.o
      icpc: command line warning #10159: invalid argument for option '-std'
      CXX code/plugin_Mock/Parameters.o
      icpc: command line warning #10159: invalid argument for option '-std'
      code/plugin_Mock/Parameters.cpp(2129): warning #68: integer conversion resulted in a change of sign
      uint64_t value=-1;
      ^

      If I run the make file without the -std=c++98 the ray program crashes during the step that follows Selection of optimal read markers

      [node195:41872] [10] /lib64/libc.so.6(__libc_start_main+0xfd) [0x33bb21ec5d]
      [node195:41872] [11] Ray() [0x469429]
      [node195:41872] *** End of error message ***
      [node193:49049] 8 more processes have sent help message help-odls-default.txt / odls-default:could-not-kill

      ==> BATCH_OUTPUT.ray4 <==
      [-9] ------> AAAAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTAC
      [-8] ------> AAAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACG
      [-7] ------> AAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGA
      [-6] ------> AAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGAC
      [-5] ------> AAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACC
      [-4] ------> AAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCT
      [-3] ------> AAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTC
      [-2] ------> AATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCA
      [-1] ------> ATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCAA
      [0] ------> TGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCAAC


      I see someone else had the same error but I didn't see a resolution for it

      Comment

      • seb567
        Senior Member
        • Jul 2008
        • 260

        #18
        Originally posted by severin View Post
        when I follow your suggestion with the developmental version I get the following errors

        icpc: command line warning #10159: invalid argument for option '-std'
        CXX code/plugin_KmerAcademyBuilder/Kmer.o
        icpc: command line warning #10159: invalid argument for option '-std'
        CXX code/plugin_Library/LibraryPeakFinder.o
        icpc: command line warning #10159: invalid argument for option '-std'
        CXX code/plugin_Library/LibraryWorker.o
        icpc: command line warning #10159: invalid argument for option '-std'
        CXX code/plugin_Library/Library.o
        icpc: command line warning #10159: invalid argument for option '-std'
        CXX code/plugin_MachineHelper/MachineHelper.o
        icpc: command line warning #10159: invalid argument for option '-std'
        CXX code/plugin_MessageProcessor/MessageProcessor.o
        icpc: command line warning #10159: invalid argument for option '-std'
        CXX code/plugin_Mock/Parameters.o
        icpc: command line warning #10159: invalid argument for option '-std'
        code/plugin_Mock/Parameters.cpp(2129): warning #68: integer conversion resulted in a change of sign
        uint64_t value=-1;
        ^

        If I run the make file without the -std=c++98 the ray program crashes during the step that follows Selection of optimal read markers

        [node195:41872] [10] /lib64/libc.so.6(__libc_start_main+0xfd) [0x33bb21ec5d]
        [node195:41872] [11] Ray() [0x469429]
        [node195:41872] *** End of error message ***
        [node193:49049] 8 more processes have sent help message help-odls-default.txt / odls-default:could-not-kill

        ==> BATCH_OUTPUT.ray4 <==
        [-9] ------> AAAAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTAC
        [-8] ------> AAAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACG
        [-7] ------> AAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGA
        [-6] ------> AAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGAC
        [-5] ------> AAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACC
        [-4] ------> AAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCT
        [-3] ------> AAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTC
        [-2] ------> AATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCA
        [-1] ------> ATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCAA
        [0] ------> TGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCAAC


        I see someone else had the same error but I didn't see a resolution for it
        http://www.mail-archive.com/denovoas.../msg00317.html
        Someone else also had the problem on 1 sample out of 15 samples during the coloring of the graph (endless processing with v2.1.0 on some samples):


        I will fix this. Maybe for the v2.2.0 release, but it will probably appear in the v2.2.1 release later.
        Last edited by seb567; 03-15-2013, 07:59 AM. Reason: added use case

        Comment

        • seb567
          Senior Member
          • Jul 2008
          • 260

          #19
          Hi,

          I did a test with the Intel compiler and everything went fine.

          Code:
          icpc: command line warning #10159: invalid argument for option '-std'
          This warning changes nothing for the Ray executable, it's just a warning saying that -std=c++98 is not an option of the Intel compiler.



          Originally posted by severin View Post
          when I follow your suggestion with the developmental version I get the following errors

          icpc: command line warning #10159: invalid argument for option '-std'
          CXX code/plugin_KmerAcademyBuilder/Kmer.o
          icpc: command line warning #10159: invalid argument for option '-std'
          CXX code/plugin_Library/LibraryPeakFinder.o
          icpc: command line warning #10159: invalid argument for option '-std'
          CXX code/plugin_Library/LibraryWorker.o
          icpc: command line warning #10159: invalid argument for option '-std'
          CXX code/plugin_Library/Library.o
          icpc: command line warning #10159: invalid argument for option '-std'
          CXX code/plugin_MachineHelper/MachineHelper.o
          icpc: command line warning #10159: invalid argument for option '-std'
          CXX code/plugin_MessageProcessor/MessageProcessor.o
          icpc: command line warning #10159: invalid argument for option '-std'
          CXX code/plugin_Mock/Parameters.o
          icpc: command line warning #10159: invalid argument for option '-std'
          code/plugin_Mock/Parameters.cpp(2129): warning #68: integer conversion resulted in a change of sign
          uint64_t value=-1;
          ^

          If I run the make file without the -std=c++98 the ray program crashes during the step that follows Selection of optimal read markers

          [node195:41872] [10] /lib64/libc.so.6(__libc_start_main+0xfd) [0x33bb21ec5d]
          [node195:41872] [11] Ray() [0x469429]
          [node195:41872] *** End of error message ***
          [node193:49049] 8 more processes have sent help message help-odls-default.txt / odls-default:could-not-kill

          ==> BATCH_OUTPUT.ray4 <==
          [-9] ------> AAAAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTAC
          [-8] ------> AAAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACG
          [-7] ------> AAAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGA
          [-6] ------> AAAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGAC
          [-5] ------> AAAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACC
          [-4] ------> AAAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCT
          [-3] ------> AAATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTC
          [-2] ------> AATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCA
          [-1] ------> ATGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCAA
          [0] ------> TGTGCCTTCGTTTCAAGTTCTATTCATTCTACGACCTCAAC


          I see someone else had the same error but I didn't see a resolution for it
          http://www.mail-archive.com/denovoas.../msg00317.html

          Comment

          • suzumar
            Junior Member
            • Sep 2012
            • 2

            #20
            Hi Sebastian and thanks for developing Ray. I am working on a sponge metagenome (ion torrent) and I am trying to setup ray for taxonomy and communities.

            I an trying to setup the files for the latest version of greengenes (2012_08) and have parsed the information in the fasta file to the same format as 2011_01, and I am trying to manually run the script

            Paper-Replication-2012 / Build-Input-Files-for-GreenGenes-Taxonomy / main.sh

            and have one question regarding fasta files for Ray Taxonomy and Communities

            I have notices that for the NCBI taxonomy the script Paper-Replication-2012 / Build-Input-Files-for-NCBI-Taxonomy / CreateRayInputStructures.sh

            Creates a single fasta file with for each genome. My question is whether those reference fasta files are just a concatenation of all .fna files associated with anty given genome. (and so there are multiples IDs and accessions associated with a given "genome". This becomes an is an issue for draft genomes (lots of scaffolds) or eukaryotic chromosomes, which I will have to "manually merge"

            Actually after I double checked the CreateRayInputStructures.sh script it seems to be the case, but would you please confirm it?

            Marcelino

            Comment

            • seb567
              Senior Member
              • Jul 2008
              • 260

              #21
              Originally posted by suzumar View Post
              Hi Sebastian and thanks for developing Ray. I am working on a sponge metagenome (ion torrent) and I am trying to setup ray for taxonomy and communities.

              I an trying to setup the files for the latest version of greengenes (2012_08) and have parsed the information in the fasta file to the same format as 2011_01, and I am trying to manually run the script
              It's good to know that there is a new release.

              Paper-Replication-2012 / Build-Input-Files-for-GreenGenes-Taxonomy / main.sh

              and have one question regarding fasta files for Ray Taxonomy and Communities

              I have notices that for the NCBI taxonomy the script Paper-Replication-2012 / Build-Input-Files-for-NCBI-Taxonomy / CreateRayInputStructures.sh

              Creates a single fasta file with for each genome. My question is whether those reference fasta files are just a concatenation of all .fna files associated with anty given genome. (and so there are multiples IDs and accessions associated with a given "genome".
              Yes. drafts can have several .fna files that can be concatenated.


              This becomes an is an issue for draft genomes (lots of scaffolds) or eukaryotic chromosomes, which I will have to "manually merge"
              You can do a bash command line to do that for you. Something like

              Code:
              mkdir merged
              
              for draft in $(ls drafts)
              do
                  cat drafts/$draft/*.fna > merged/$draft.fasta
              done
              Actually after I double checked the CreateRayInputStructures.sh script it seems to be the case, but would you please confirm it?

              Marcelino
              Yes. this the code below does what you said:

              Code:
              if test ! -d NCBI-Finished-Bacterial-Genomes
              then
                      echo "Creating $OutputDirectory/NCBI-Finished-Bacterial-Genomes, please wait."
              
                      mkdir NCBI-Finished-Bacterial-Genomes
                      cd NCBI-Finished-Bacterial-Genomes
              
                      for i in $(ls ../uncompressed/all.fna)
                      do
                              name=$(echo $i|sed 's/_uid/ /g'|awk '{print $1}')
              
                              cat ../uncompressed/all.fna/$i/*.fna > $name".fasta"
                      done
              
                      echo "Done."
              
                      cd ..
              fi

              Comment

              • seb567
                Senior Member
                • Jul 2008
                • 260

                #22
                Ray v2.2.0 is now available.

                Hello,

                Ray v2.2.0 is now available worldwide.

                The delay between v2.1.0 and v2.2.0 was quite huge.

                Ray v2.2.0 brings a lot of bug fixes and some new features.

                The tarball is available at:







                The most significant changes include:

                * SequencesLoader: the Illumina export format is now supported
                * add build option for MPI I/O
                * void infinite loops during read recycling
                * messages must not be passed by value
                * Fixed a linking error caused by ordering
                * FusionTaskCreator: don't lose genomic regions during merging
                * new file GraphPartition.txt shows the distribution of objects
                * readahead operations are used for reading gz files
                * core: fixed a race condition occurring with -route-messages
                * SeedingData: fix regression for seed checkpointing
                * all the code of Ray was ported to this new GraphPath framework

                The GraphPath framework reduces the memory usage and avoid some misassembly
                errors by enforcing the Bruijn graph property.

                * Scaffolder: don't fetch reads from repeated objects

                This fixes running time issues on large genomes with repeats.

                * SeedingData: implemented a staggered mean algorithm

                * Mock: removed the limit on the number of input files
                * Library: implemented checkpointing for paired reads
                * removed all calls to fflush(stdout) and cout.flush()
                * SeedExtender: reduce the verbosity of graph traversal
                * reduced the amount of information in the standard output
                * JoinerTaskCreator: reduced the default verbosity
                * KmerAcademyBuilder: reduced the verbosity for graph construction
                * implemented an adaptive Bloom filter
                * store a path as a sequence instead of a vector of vertices for efficiency
                * SequencesLoader: add support for short file names





                All changes in Ray between v2.1.0 and v2.2.0

                Charles Joly Beauparlant (1):
                Added an example plugin.

                Sébastien Boisvert (160):
                Some work around the minirank model.
                Ported Ray plugins to the mini-ranks RayPlatform.
                Ray plugins were ported to the mini-ranks.
                Moved the destruction of allocators in RayPlatform.
                I ported Ray to some changes in some classes in RayPlatform.
                application_core: the application code was simplified
                Social networks were added to the release procedure
                Code names of old releases were added
                Fixed a linking error caused by ordering
                Fixed the scope of options in build system
                The build system was simplified
                AR and LD are not needed here
                Ray must abort if the output directory exists
                The RayCommand.txt file was fixed for mini-ranks
                Added the name of each rank (or mini-rank) in network test
                The subgraph must be built regardless if it will be used
                Merge branch 'minirank-model' of git://github.com/sebhtml/ray.git
                core: CONFIG_* variables are private
                core: The option -mini-rank-per-rank was added
                ship: removed 6 files in shipped products
                core: don't return parameters by value
                Mock: new plugin called that does nothing
                SequencesLoader: a regression for .bz2 file support was fixed
                messages must not be passed by value
                Ordered all headers
                Updated copyrights
                Documentation: there is only one repository for research tools
                reverted a wrong hunk from commit 7c361f1530d084c6f99
                FusionTaskCreator: don't lose genomic regions during merging
                SeedExtender: properly format extension file name
                Scaffolder: only put one new line after scaffold sequence
                KmerAcademyBuilder: use vertexRank() to find who owns an object
                new file GraphPartition.txt shows the distribution of objects
                the line that shows the process identifier was moved
                CoverageGatherer: kmers.txt should have 1 header only
                recursive make was improved
                readahead operations are used for reading gz files
                SequencesLoader: added the rank number when loading files
                core: the partitioner needs the correct rank number
                core: fixed a race condition occurring with -route-messages
                SeedExtender: display the number of traversed nucleotide symbols
                Seeds: new runtime metrics for seeding algorithms
                new header for SeedLengthDistribution.txt
                new header for any paired read file LibraryN.txt
                SequencesLoader: added a few assertions for read partitions
                new header for CoverageDistribution.txt
                Merge branch 'master' of github.com:sebhtml/ray
                Documentation: added the polytope with 4225 vertices
                SeedingData: fix regression for seed checkpointing
                added documentation for using the torus
                Documentation: added arguments for a 5D torus with 1024 vertices
                Documentation: fixed permissions
                removed the output file called MessagePassingInterface.txt
                renamed the AssemblySeed to GraphPath so it can be reused
                all the code of Ray was ported to this new GraphPath framework
                Documentation: fixed the degree of the polytope
                Scaffolder: don't fetch reads from repeated objects
                SeedExtender: added documentation in the code for repeated vertices
                fixed a couple of compilation warnings
                SeedingData: implemented a staggered mean algorithm
                Scaffolder: replaced getMode() by the new GraphPath framework
                Mock: removed the limit on the number of input files
                remove the limitation regarding the maximum number of files
                moved message handlers from MessageProcessor to SequencesLoader
                Scaffolder: fixed 2 compilation warnings
                Library: implemented checkpointing for paired reads
                SeedingData: reduced amount of printed information
                removed all calls to fflush(stdout) and cout.flush()
                SeedExtender: reduce the verbosity of graph traversal
                reduced the amount of information in the standard output
                JoinerTaskCreator: reduced the default verbosity
                KmerAcademyBuilder: reduced the verbosity for graph construction
                SequencesLoader: reduced verbosity
                VerticesExtractor: reduced verbosity
                reduced verbosity
                reduced verbosity
                SequencesLoader: the Illumina export format is now supported
                added a loader interface for file formats
                SequencesLoader: all supported formats use the interface
                SequencesLoader: implemented a product factory
                Mock: updated documentation for new export format
                Mock: output a single file for library data
                implemented an adaptive Bloom filter
                improved the interface of path objects
                add debug symbols by default
                store a path as a sequence instead of a vector of vertices for efficiency
                Mock: the path storage using blocks is not ready
                SeedingData: enforce de Bruijn graph property for path storage
                SeedingData: use the GraphPath storage code to compute seeds
                SeedingData: refactor code so that m_content is abstracted
                SeedingData: use 2-bit encoding for paths
                SeedingData: plugin options are parsed by plugins
                use constants for symbols
                SeedingData: correctly detect dead ends
                add more information for coding style
                MachineHelper: registerPlugin and resolveSymbols must be last
                SeedingData: tips can not be seeds
                SequencesLoader: add support for short file names
                SeedingData: tips are not valid seeds
                move some handlers in the Scaffolder plugin
                Scaffolder: implement the handler for packed chunks
                fix a race condition during directory probing
                reduce verbosity of components
                add documentation for building on IBM Blue Gene/Q
                add code name for upcoming release
                SequencesLoader: fix regression (added in ca979832) for line widths
                add plugin PathEvaluator to evaluate paths
                PathEvaluator: write ContigPaths checkpoints in parallel
                reserve storage capacity for sequence file
                perform parallel I/O operations
                fix a bug when disabling scaffolding
                use MPI I/O to write Contigs.fasta
                use a file view for each MPI rank
                add build option for MPI I/O
                avoid parallel I/O without MPI I/O
                avoid infinite loops during read recycling
                update polytope documentation
                add comments for old class
                add a new plugin to process spurious seeds
                port some plugins to the simplified RayPlatform API
                iterate on seeds to filter them
                register seed paths in the distributed graph
                hide hash values for Bloom filter
                push the workflow in a helper class
                fetch ancestors of seed heads
                seed lengths must be collected after analysis
                write seed statistics after analysis
                write seed checkpoints after the quality control analysis
                write seed files after analysis (-write-seeds)
                skip seed quality analysis if checkpoints exist
                add steps for better dead end detection
                hide mini-ranks in help if they are disabled
                correct a bunch of bugs for adapters in Ray
                reuse code paths to obtain sequence information
                eliminate seeds that have a dead-end on the left
                discard seeds with dead-ends on the right
                increase the maximum depth for searches
                add a class to fetch the attributes of a DNA sequence
                create a class to fetch annotations in a portable way
                fetch nearby paths to detect bubbles
                fix a bug during the registration of seeds
                remove any seed that is a weak part of a bubble
                add 4 methods that will be implemented later
                fix a regression that prevented the closing of a file
                add new reference in the output
                disable the seed filter when using short kmers
                add a maximum coverage depth for dead end search
                adapt the allowed depth in function of the data
                add design blueprints for the new plugin
                SpuriousSeedAnnihilator: disable debug messages by default
                TaxonomyViewer: rename the plugin to TaxonomyViewer
                remove plugin_ from all plugin directory names
                add new line for publications
                application_core: fix buggy message routing
                SeedExtender: don't traverse path if it's consumed already
                SeedingData: fix a bug for the phix system test
                update the CMakeList.txt
                use git to store version names
                Disable the filtering code during the computation of seeds
                This is Ray v2.2.0




                All changes in RayPlatform between v1.1.0 and v1.1.1


                Sébastien Boisvert (56):
                initial work on miniranks with VirtualMachine and Minirank
                I added some design documentation for mini-ranks.
                spinlocks are more suitable for this job
                added design documentation for mini-ranks.
                First implementation of mini-ranks in RayPlatform
                The core must provide the mini-rank number.
                Documentation: added description of macros.
                Fixed some bugs in the mini-ranks model.
                Moved the destruction of allocators in the core.
                Mini-rank source and mini-rank destination are required.
                The desctructor of the middleware must be called.
                A mini-rank must tell the rank that it has messages to send.
                The class MessageQueue does the job of receiving messages.
                Non-blocking queues will be used for the communication.
                The non-blocking message queue for mini-ranks is ready.
                MPI_Recv must be called to get the mini-rank numbers.
                This is the branch for RayPlatform v7.0.0.
                core: The old behavior (no mini-ranks) now works as expected
                core: RayPlatform is responsible for creating mini-ranks
                The old adapter API documentation was removed
                Message reception is now interleaved with send operations.
                More buffers are needed for mini-ranks
                communication: don't register already registered buffers
                The build system is less verbose
                New API call to get the number of mini-ranks per rank
                Added a method to get the MessagesHandler object
                Merge branch 'minirank-model' of github.com:sebhtml/RayPlatform into minirank-model
                Merge branch 'minirank-model' of git://github.com/sebhtml/RayPlatform.git
                handlers: new option to cache operation codes
                communication: messages must be passed with a pointer
                Ordered headers in all files
                Updated copyrights
                The short name was updated in headers
                The website was updated in every file
                a retry is necessary when a message is pushed into a full ring
                Documentation: updated RayPlatform mini-ranks blueprints
                communication: moved writeFiles() in a second method
                communication: removed a few debugging instructions
                Documentation: added gate blueprints
                Documentation: improved design for non-linear scheduling
                routing: renamed the hypercube to polytope
                Documentation: added Torus description
                a radix of 2 produces a hypercube
                use the Q and ASSERT build arguments in RayPlatform
                routing: implemented a new communication graph: the torus
                Merge branch 'master' of github.com:sebhtml/RayPlatform
                core: use specific code to get memory usage on Blue Gene/Q
                the next release will likely be 1.2.0 and not 7.0.0
                add option to provide public access to a master mode
                add the core in each plugin
                add two macros to configure handlers
                fixed directives to compile mini-ranks
                core: fix buggy message routing
                improve the patch for message routing with a configuration
                core: fix a regression for registered handle names
                This is RayPlatform v1.1.0.

                Comment

                • vpp605
                  Junior Member
                  • Feb 2009
                  • 6

                  #23
                  Ray Meta - taxonomy and gene ontology

                  Hello,

                  I have a general question about the way Ray Meta works. When the taxonomy and gene ontology profiles are provided, I assume that is only for the assembled contigs? Or would that also include results for reads that were not assembled into contigs?
                  We have fairly low read coverage for our samples, so I anticipate a large portion of the reads will not be assembled into contigs. As such, is there a way to get the taxonomy and gene ontology profiles of the entire data set (i.e., contigs and any reads that were not assembled into contigs)?

                  Thanks in advance for your response, and complements to your group on the paper describing Ray Meta. The thorough documentation and supplementary material is very much appreciated!

                  Comment

                  • seb567
                    Senior Member
                    • Jul 2008
                    • 260

                    #24
                    Originally posted by vpp605 View Post
                    Hello,

                    I have a general question about the way Ray Meta works. When the taxonomy and gene ontology profiles are provided, I assume that is only for the assembled contigs? Or would that also include results for reads that were not assembled into contigs?
                    We have fairly low read coverage for our samples, so I anticipate a large portion of the reads will not be assembled into contigs. As such, is there a way to get the taxonomy and gene ontology profiles of the entire data set (i.e., contigs and any reads that were not assembled into contigs)?

                    Thanks in advance for your response, and complements to your group on the paper describing Ray Meta. The thorough documentation and supplementary material is very much appreciated!
                    As explained in the paper, the profiling is done on de Bruijn subgraph.

                    So you should be OK with your low coverage data I think.

                    Comment

                    • jjjscuedu
                      Member
                      • Mar 2012
                      • 35

                      #25
                      ray moi running problem

                      Dear all,

                      I am trying to run Ray on a test data.

                      However, when I try to run it according to the mannual, there is an error like this:


                      [jingjing@tll-bioinfo02 Ray-v2.2.0]$ mpiexec -n 1 ray-build/Ray -o test -p PE1.fa PE2.fa -k 31
                      ssh: Could not resolve hostname tll-bioinfo02: Name or service not known

                      It seems the mpi mode is something wrong.

                      Can anyone give me some suggestions?

                      Thanks!

                      Comment

                      • seb567
                        Senior Member
                        • Jul 2008
                        • 260

                        #26
                        Originally posted by jjjscuedu View Post
                        Dear all,

                        I am trying to run Ray on a test data.

                        However, when I try to run it according to the mannual, there is an error like this:


                        [jingjing@tll-bioinfo02 Ray-v2.2.0]$ mpiexec -n 1 ray-build/Ray -o test -p PE1.fa PE2.fa -k 31
                        ssh: Could not resolve hostname tll-bioinfo02: Name or service not known

                        It seems the mpi mode is something wrong.

                        Can anyone give me some suggestions?

                        Thanks!
                        The problem is related to your MPI installation. It seems that mpiexec wants to use ssh to connect to tll-bioinfo02.

                        Maybe tll-bioinfo02 is listed in a hostfile and that your MPI installation is using that.

                        Try:

                        mpiexec -n 1 -host localhost ray-build/Ray -o test -p PE1.fasta PE2.fasta -k 31

                        Comment

                        • seb567
                          Senior Member
                          • Jul 2008
                          • 260

                          #27
                          Ray 2.3.0

                          Hello,

                          I am proud to announce the immediate availability of Ray 2.3.0 (434 KB).



                          Most significant change:

                          - add -detect-sequence-files to detect supported files

                          With this option, you just need to put your sequence data files in one directory,
                          and use "mpiexec -n 99 Ray -detect-sequence-files directory. This option will match
                          paired files and everything.

                          What's new:

                          - new option "-run-surveyor" to compare several samples (see Documentation/)
                          - support long reads in -amos option (reported by Bastian Hornung @ wur.nl)
                          - Scaffolder: fix a bug in the formatting of scaffolds (Rob Egan @ Lawrence Berkeley Laboratory)
                          - ElapsedTime.txt is now in tabular format (suggested by James Vincent @ The University of Vermont)
                          - add new sequence file extensions such as .fq.gz (see the manual)
                          - fix a interger overflow for the Bloom filter (thanks to Chien-Chi Lo)
                          - remove the symbolic loop in RayPlatform (reported by Nick Holway)
                          - add the ability to send SIGUSR1 to Ray processes to debug them
                          - use the polytope by default with option -route-messages (instead of the de Bruijn graph)


                          Download link:



                          Mirrors:






                          Thanks !

                          Sébastien

                          -----

                          Paper for Ray Meta for metagenomics:


                          Ticket for the release:
                          [boisver1@cp1664-mp2 ray]$ cat Documentation/RELEASE_PROCEDURE.txt ­un regression tests (+backup on colosse) #199 run unit tests #212 test on Qin et al. 2010 compile with make compile with cmake up...

                          Comment

                          • canderson30
                            Junior Member
                            • Nov 2012
                            • 2

                            #28
                            Hello,

                            When I look through some outputs generated from the amos file following assembly, many of the contigs were assigned 0 reads (used default bank2contig after seeing many contigs were not showing up in the generated sam file). Obviously, this does not make much sense, but I was wondering if anyone else has came across this? I was trying to avoid mapping by using the amos file and now I just want to confirm that the contigs I am getting are 'real' I suppose.

                            I thought this may be due to read recycling at first, but reads show up under multiple contigs still. Anyone have other ideas what is causing this issue or how to correct it during assembly?


                            Chris

                            Comment

                            • amitbik
                              Member
                              • May 2013
                              • 53

                              #29
                              Abyss &amp; ray

                              Hi, Everyone

                              I am doing metagenomic shotgun assembly in Abyss and Ray i got the result but i wanted to know how many reads are used and unused?
                              I tried but failed. can anyone just guide me to find out?

                              Any help will be appreciated...

                              Comment

                              • amitbik
                                Member
                                • May 2013
                                • 53

                                #30
                                Hi, All

                                Please help me guys...

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  Today, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  Yesterday, 05:17 AM
                                • GATTACAT
                                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                  by GATTACAT
                                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                  07-01-2026, 11:43 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 10:04 AM
                                0 responses
                                8 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, Yesterday, 10:08 AM
                                0 responses
                                7 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-07-2026, 11:05 AM
                                0 responses
                                9 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-02-2026, 11:08 AM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...