Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • illuminaGA
    Member
    • Dec 2012
    • 71

    Lots of "N" in the barcode.

    Dear All

    I am new to NGS and GAII.

    After several test running ,we have a big problem.

    We usually have 6 samples with different barcode(index 2,3,4,7,9,10) in one lane. We have 3.5G data totally in each lane, but the CASAVA only can demultiplexing 64M.

    Most of data under Undetermined_indices fold are like this.


    @=78@==<:=BDDDDGEGG?===B@>ACBAGGGG@DD==>EEE?EDGE3GEEC>>,838<E>>C???D?=6(/9?:?########################
    @ILLUMINA-8ACF53:7:FC:1:52:5835:9761 1:N:0:NNNNGN
    TAAACTTTATAATTAAAAAAAAATGCTCATTTGAGCTGCAATAGTTTTACTAACTTTTAATGTCTTAATTCAAATACCCAGTTTCCATAACATAATATCTA

    There lots of N in the barcode,so CASAVA cann't demultiplex samples.

    We have a little bit overclustering. %PF of my sample is only 29.5+/- 27.32. Is this the main reason?

    How to make troubleshooting with this?

    Thank you so much.
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    There is nothing you are going to be able to do when samples are over-clustered (~30% PF is a clear indication) and the tag read fails this way.

    You will have to re-run these samples at a lower density.

    Comment

    • illuminaGA
      Member
      • Dec 2012
      • 71

      #3
      Thank you so much.

      How to improve the %PF? Do you have some advises?

      Originally posted by GenoMax View Post
      There is nothing you are going to be able to do when samples are over-clustered (~30% PF is a clear indication) and the tag read fails this way.

      You will have to re-run these samples at a lower density.

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Originally posted by illuminaGA View Post
        Thank you so much.

        How to improve the %PF? Do you have some advises?
        This would be a good case where you should contact Illumina tech support so you can get comprehensive help from them.

        As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries.

        You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem.

        Comment

        • illuminaGA
          Member
          • Dec 2012
          • 71

          #5
          Thank you so much.

          I only got this problem in lane1 and lane2. And the every sample's concentration of lane1 is 8pM.

          The cluster Density is 1153+/-98,Cluster PF is 29.46+/- 27.44.

          This is the first time that I prepared the library by myself. And Lane1 is the TEST lane. The other lanes were good libraries.

          I measured the concentrations by Bioanalyzer since our Real-time PCR meachine was out of order. So I think the concentrations were not accurate.

          Thank you so much again.




          Originally posted by GenoMax View Post
          This would be a good case where you should contact Illumina tech support so you can get comprehensive help from them.

          As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries.

          You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem.
          Last edited by illuminaGA; 04-24-2013, 08:33 AM.

          Comment

          • illuminaGA
            Member
            • Dec 2012
            • 71

            #6
            Originally posted by GenoMax View Post
            This would be a good case where you should contact Illumina tech support so you can get comprehensive help from them.

            As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries.

            You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem.
            Hello GenoMax

            I sent all may SAV file to illumina techsupport ,after analyzed my data,they said that "HP8 did not hybridize with those IDT sample preps. The intensity readings of index 1 is nearly zero, which accounts for not seeing index counts in your results. Since the index 1 worked in the other lanes, it is likely not a index primer fluidics issue on the instrument. This would also confirm the effectiveness of the HP8 primer in the system."

            I used IDT Y shape TruSeq dup Adapter for my libraries preparation. The sequence of the adapter as follow.

            TruSeq Universal Adapter
            AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGA TC *T-3


            TruSeq Indexed Adapter
            GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACA-CGAGAAGGCTAG*P-5


            I ordered TruSeq SBS Kit v5 - GA (36-cycle)(FC-104-5001) for our GA IIx and TruSeq PE Cluster Kit v2(PE-300-2001) for cBot.

            Did I make mistake about my adapters?

            Thanks

            Comment

            • kcchan
              Senior Member
              • Jul 2012
              • 186

              #7
              I don't think the adapters were the problem. As the others have said, you were way too overclustered in that lane. You can try upping the mismatch rate or playing with the failed reads to get some more data back, but the chances of getting even 50% of your data back are pretty slim.

              Next time you encounter overclustering in your flow cell, I would suggest immediately performing a strip and rehyb of your primers and restarting the run. This will usually lower the cluster density a little bit.

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM
              • SEQadmin2
                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                by SEQadmin2



                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                07-08-2026, 05:17 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              25 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-23-2026, 11:41 AM
              0 responses
              20 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-20-2026, 11:10 AM
              0 responses
              26 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-13-2026, 10:26 AM
              0 responses
              38 views
              0 reactions
              Last Post SEQadmin2  
              Working...