Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • jmwhitha
    Senior Member
    • Mar 2013
    • 107

    #1

    BWA gives no alignment lines in SAM file

    Good morning,

    I am trying to map simulated reads generated from GemSIM to an index generated from a multi-fasta of the CLJU (bacteria) coding sequence from NCBI. I used these two commands and discovered there were no alignment lines in the SAM file, only header lines. Commands head and tail only returned lines starting with @, and grep -vnm1 '^@' returned nothing.

    bwa-0.7.3a/bwa index -a is -p CLJU ./CLJUcoding.fasta

    bwa-0.7.3a/bwa mem CLJU CLJUsimreadsCodeTrial.single.fastq > CLJUsimreadsCodeTrial.single.sam

    Any suggestions?

    Thanks and God bless,
    Jason
  • mastal
    Senior Member
    • Mar 2009
    • 666

    #2
    BWA gives no alignment lines in SAM file

    Did you get any error messages or other output when you ran BWA?

    I think your syntax is not quite right, according to the bwa manual page


    it should be
    bwa-0.7.3a/bwa mem ./CLJUcoding.fasta CLJUsimreadsCodeTrial.single.fastq > CLJUsimreadsCodeTrial.single.sam

    Comment

    • jmwhitha
      Senior Member
      • Mar 2013
      • 107

      #3
      Hello mastel,

      I did not get any error messages. In addition to my CLJUsimreadsCodeTrial_single.sam, I got a CLJU.amb, CLJU.ann, CLJU.bwt, CLJU.pac, and CLJU.sa. My CLJU.amb contains just one problem character according to head command ("3909174 4184 0"). The ann file looks like it contains appropriate text, and the rest of the files are not human readable.

      Tried your syntax suggestion and got back: "[E::bwa_idx_load] fail to locate the index files". This message did not occure when I used the syntax in the post above.

      Any other suggestions? Thank you very much.

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Originally posted by jmwhitha View Post
        Hello mastel,

        My CLJU.amb contains just one problem character according to head command ("3909174 4184 0").
        What do you mean by "contains one problem character"?

        Are there spaces in identifier names in your genome reference file? How large is your reference file? What OS are you running this on?

        Can you post a few example lines from your sequence and reference files?

        Comment

        • jmwhitha
          Senior Member
          • Mar 2013
          • 107

          #5
          According to http://seqanswers.com/forums/showthread.php?t=20556, the .amb (ambiguous file) contains illegal characters. xied75 intentionally put an R and an S into his fasta file and got back two problem characters: 249240584 1 R and 249240585 1 S. The numbers I assume are coordinates of some sort, and my illegal character is "0".

          Yes there are spaces in the multi-fasta file I am using as a reference. According to "grep -c \ CLJUcoding.fasta" there are "4184".

          Genome Reference File
          "stat -c %s CLJUcoding.fasta" gives "4609956" (bytes) for the file size.
          Grabbing a sample from the head using "head -n30 CLJUcoding.fasta" I get:
          >lcl|NC_014328.1_cdsid_YP_003778217.1 [gene=dnaA] [protein=chromosomal replication initiator protein] [protein_id=YP_003778217.1] [location=101..1453]
          ATGAATGCCCATCCAAAAGAAATATGGGAACAATCTTTAAACATAATAAATGGTGAAATTACTGAAGTAAGCTTTAACACATGGATTAAAAGTATTACTCCTGTATCTATTGAAAATGACACCTTCATATTAAGTGTACCAAATGACCTTACCAAAGGCATATTAACTAGTAAATATAAAAATTTAATAGCTAATGCTCTAAAATTAATTACTTCAAAAAAATACAACATTAAATTTTTAATTGCCTCTGAATCAGAAGAAGCTTTAACATTAGACAATACTAATAAAAGACACAATAAAAATTCCGTATTGGTAAATGATGAAATGTCAACCATGCTAAATCCAAAATATACTTTTGATTCCTTCGTTATAGGTAATAGTAATAGATTCGCTCATGCAGCTTCACTTGCTGTAGCTGAATCACCTTCAAAAGCATATAATCCCCTATTCATATACGGAGGCGTAGGACTAGGCAAAACTCATTTAATGCATGCTATAGGACACTACATATTAAACAATAATAGTAAATCTAAAGTAGTATACGTTTCATCTGAAAAATTTACAAACGAACTTATAAATTCAATAAAAGATGATAAAAATGTAGAATTCAGAAATAAATATAGAAATATAGATGTACTCTTAATAGATGATATACAATTTATTGCAGGTAAAGAAAGAACCCAAGAGGAATTTTTTCATACCTTTAATGCATTATACGAGGCTAATAAACAAATAATTCTATCTAGTGATAGACCACCAAAAGAAATCCCTACATTAGAAGATAGACTTAGATCTAGGTTTGAATGGGGACTTATAGCAGACATTCAACCACCAGACTTTGAAACTAGAATGGCTATATTAAAAAAGAAGGCAGACGTCGAAAATTTAAATATTCCTAATGAAGTAATGGTGTATATAGCTACTAAAATTAAATCCAACATTAGAGAACTTGAAGGTGCGCTAATAAGAATAGTCGCTTTCTCCTCACTTACAAATAAAGAAATAAGTATAGATTTGGCAGTAGAAGCTTTAAAAGATATAATTTCAAGCAAACAATCAAAACAAGTTACTATAGACTTAATACAAGATGTAGTTGCCAACTATTATAACTTAAAAGTAGATGATTTAAAATCTGCAAGAAGAACAAGAAATGTAGCTTTTCCAAGGCAAATAGCTATGTACTTGTGTAGAAAACTTACAGATATGTCTTTGCCAAAAATCGGAGAAGAATTTGGCGGAAGAGATCATACTACCGTAATACATGCTTATGAAAAAATATCAACTAATTTAAAACAAGATGAAAGTCTTCAAAATGCTATAGGCGATTTAACAAAACGACTAAATCAAAATTAA
          >lcl|NC_014328.1_cdsid_YP_003778218.1 [gene=dnaN] [protein=DNA polymerase III subunit beta] [protein_id=YP_003778218.1] [location=1710..2813]
          ATGAACTTTATATGTACAAAAACAGAATTACAAGAAGCTATTTCAATAGCACAAAAAGCTATCACAGGGAAATCCAGCATGCCAATATTAAATGGTCTACTTATTACAACCTGTAAAAACCAAATTAAATTAACTGGATCAGATATAGACCTCAGTATAGAAACAAAAATAAATGCAGAAATAAAAGAAGAGGGATCCGTAGTAGTTGATTCTAGACTATTTGGAGAAATTATAAGAAAATTACCTAATGACAATATAAATATTTCTACTACAGAAAATAATTCAATAGAAATAATATGTCAAAAATCTAAATTTAATCTAATTCATATGAATGCAGAAGATTTTCCTGAAATACCTAATATAAATGAAAATATTATTTTCTTAATACCTCAAAAAATATTAAAAGATATGATAAAAAGTACTATTTTTGCTGCAGCTCAAGATGAAACTAGACCTATACTTACAGGAATTTTATTTGAAATCAAGGACAAAAAATTAAATTTAGTAGCATTAGACGGATATAGATTAGCTTTAAAATCAGAATATCTTAATACAGAAAA

          And for my fastq sequence (just first 10 lines):
          jmwhitha@Linux-OptiPlex-755:~$ head CLJUsimreadsCodeTrial_single.fastq
          @r1_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
          GACTCCTTGCAGCTGGGGAGGTAGAATACCCGATTATTATATTAGTCTAAAAATTGATAATGGTAAGCATTTGTTTTTAATAAATGAATTTCATAATGGG
          +
          IIIIGDIHIIIIDIIIIHIIIIDIHIIIIEIDFBIIF>HIIEEIIIIIFDEHEGH(IHF#IIHG#@HDGG@BGGBHGHBGD<HBBHIH@D>=BBGG@E>B
          @r2_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
          TATGGACTTGGTCTAATTTCATGTTGAACTTTATATTCCAGGACTTATTGGTTTCCACATCATTTCCTATAGTAATTCCGCTGTAATTAATTGCATGTAC
          +
          IDIIIIIIGIHHIIGIGIIIGIIIIIGIIIGDIIIHII@IIIICIIIGI=FIGIIGIGIBEIGHHHIHIE2GHHGHHHH?HIHGB=GIB?#6H>>EG@EC
          @r3_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
          TAATGGAAAAAAACTACTTATAGATTGTGGTGAGGGAACTCAAGTTAGCTTAAAAATACTTGGATGTAAAATAAAAAATATAGATGTAATTTTATTTACA

          Sorry, can't help the line wrapping.

          What do you think?

          Thank you again respondents.

          Comment

          • jmwhitha
            Senior Member
            • Mar 2013
            • 107

            #6
            Or actually, lack of wrapping.

            Comment

            • GenoMax
              Senior Member
              • Feb 2008
              • 7142

              #7
              I was able to generate a sam file (attached) using the test sequences you had included in previous post.

              Is the bwa you are trying to use known to work correctly? Did you download and compile it yourself?
              Attached Files

              Comment

              • jmwhitha
                Senior Member
                • Mar 2013
                • 107

                #8
                Oh, great!

                Yes, I downloaded and compiled it, but had some issues. See http://seqanswers.com/forums/showthread.php?t=29498

                What version of bwa are you using? I am using 0.7.3a

                Thank you so much!

                Comment

                • GenoMax
                  Senior Member
                  • Feb 2008
                  • 7142

                  #9
                  Originally posted by jmwhitha View Post
                  Oh, great!

                  Yes, I downloaded and compiled it, but had some issues. See http://seqanswers.com/forums/showthread.php?t=29498

                  What version of bwa are you using? I am using 0.7.3a

                  Thank you so much!
                  I did use 0.7.3a.

                  I think there is something wrong with your copy of bwa. You are not going to go far until that is fixed.

                  I assume you are the "sys admin" for this machine (since it appears to be a desktop). What flavor of linux are you running (is it running natively or as a virtual machine)?

                  I just noticed that there is bwa v. 0.7.4. out. Give that a shot to see if you fare better with the compilation.

                  Comment

                  • jmwhitha
                    Senior Member
                    • Mar 2013
                    • 107

                    #10
                    I used the following command to get the newest version of bwa from sourceforge:
                    wget http://sourceforge.net/projects/bio-...d?source=files -O bwa.tar.bz2

                    Then I opened the tarball and went into the directory with:
                    tar -xjf bwa.tar.bz2
                    cd bwa-0.7.4

                    This is what happens when I execute "make":

                    gcc -c -g -Wall -O2 -DHAVE_PTHREAD utils.c -o utils.o
                    gcc -c -g -Wall -O2 -DHAVE_PTHREAD kstring.c -o kstring.o
                    gcc -c -g -Wall -O2 -DHAVE_PTHREAD ksw.c -o ksw.o
                    In file included from ksw.c:28:0:
                    /usr/lib/gcc/i686-linux-gnu/4.7/include/emmintrin.h:32:3: error: #error "SSE2 instruction set not enabled"
                    ksw.c:44:2: error: unknown type name ‘__m128i’
                    ksw.c: In function ‘ksw_qinit’:
                    ksw.c:67:11: error: ‘__m128i’ undeclared (first use in this function)
                    ksw.c:67:11: note: each undeclared identifier is reported only once for each function it appears in
                    ksw.c:67:19: error: expected expression before ‘)’ token
                    ksw.c: In function ‘ksw_u8’:
                    ksw.c:110:2: error: unknown type name ‘__m128i’
                    ksw.c:126:2: warning: implicit declaration of function ‘_mm_set1_epi32’ [-Wimplicit-function-declaration]
                    ksw.c:127:2: warning: implicit declaration of function ‘_mm_set1_epi8’ [-Wimplicit-function-declaration]
                    ksw.c:133:3: warning: implicit declaration of function ‘_mm_store_si128’ [-Wimplicit-function-declaration]
                    ksw.c:140:3: error: unknown type name ‘__m128i’
                    ksw.c:141:3: warning: implicit declaration of function ‘_mm_load_si128’ [-Wimplicit-function-declaration]
                    ksw.c:142:3: warning: implicit declaration of function ‘_mm_slli_si128’ [-Wimplicit-function-declaration]
                    ksw.c:150:4: warning: implicit declaration of function ‘_mm_adds_epu8’ [-Wimplicit-function-declaration]
                    ksw.c:151:4: warning: implicit declaration of function ‘_mm_subs_epu8’ [-Wimplicit-function-declaration]
                    ksw.c:153:4: warning: implicit declaration of function ‘_mm_max_epu8’ [-Wimplicit-function-declaration]
                    ksw.c:177:5: warning: implicit declaration of function ‘_mm_movemask_epi8’ [-Wimplicit-function-declaration]
                    ksw.c:177:5: warning: implicit declaration of function ‘_mm_cmpeq_epi8’ [-Wimplicit-function-declaration]
                    ksw.c:183:3: warning: implicit declaration of function ‘_mm_srli_si128’ [-Wimplicit-function-declaration]
                    ksw.c:183:3: warning: implicit declaration of function ‘_mm_extract_epi16’ [-Wimplicit-function-declaration]
                    ksw.c: In function ‘ksw_i16’:
                    ksw.c:228:2: error: unknown type name ‘__m128i’
                    ksw.c:244:2: warning: implicit declaration of function ‘_mm_set1_epi16’ [-Wimplicit-function-declaration]
                    ksw.c:256:3: error: unknown type name ‘__m128i’
                    ksw.c:260:4: warning: implicit declaration of function ‘_mm_adds_epi16’ [-Wimplicit-function-declaration]
                    ksw.c:262:4: warning: implicit declaration of function ‘_mm_max_epi16’ [-Wimplicit-function-declaration]
                    ksw.c:266:4: warning: implicit declaration of function ‘_mm_subs_epu16’ [-Wimplicit-function-declaration]
                    ksw.c:282:5: warning: implicit declaration of function ‘_mm_cmpgt_epi16’ [-Wimplicit-function-declaration]
                    make: *** [ksw.o] Error 1

                    Do you know why this is happening?

                    Comment

                    • jmwhitha
                      Senior Member
                      • Mar 2013
                      • 107

                      #11
                      Sorry, I forgot to answer your other questions.

                      Yes, I am. Desktop. Running natively.

                      Comment

                      • GenoMax
                        Senior Member
                        • Feb 2008
                        • 7142

                        #12
                        Originally posted by jmwhitha View Post

                        Yes, I am. Desktop. Running natively.
                        Can you post the output of:

                        Code:
                        uname -a
                        I am wondering what linux distribution of a recent vintage does not come with a functional compiler? What exact distro of linux are you using?

                        Comment

                        • jmwhitha
                          Senior Member
                          • Mar 2013
                          • 107

                          #13
                          Linux Linux-OptiPlex-755 3.5.0-27-generic #46-Ubuntu SMP Mon Mar 25 20:00:05 UTC 2013 i686 i686 i686 GNU/Linux

                          I hope that is the case. If it is, what compiler should I get? I have the latest version of protobuf-compiler according to apt-get.

                          Comment

                          • jmwhitha
                            Senior Member
                            • Mar 2013
                            • 107

                            #14
                            I also did the build-essentials.

                            Comment

                            • GenoMax
                              Senior Member
                              • Feb 2008
                              • 7142

                              #15
                              I wonder if you have some kind of software conflict with compilers.

                              Code:
                              sudo apt-get install gcc
                              should have been all that was needed

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                by SEQadmin2



                                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                ...
                                07-31-2026, 11:01 AM
                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 10:35 AM
                              0 responses
                              10 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-06-2026, 07:41 AM
                              0 responses
                              27 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 08-03-2026, 10:13 AM
                              0 responses
                              46 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-31-2026, 02:55 AM
                              0 responses
                              48 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...