BWA gives no alignment lines in SAM file

[jmwhitha]

Good morning,

I am trying to map simulated reads generated from GemSIM to an index generated from a multi-fasta of the CLJU (bacteria) coding sequence from NCBI. I used these two commands and discovered there were no alignment lines in the SAM file, only header lines. Commands head and tail only returned lines starting with @, and grep -vnm1 '^@' returned nothing.

bwa-0.7.3a/bwa index -a is -p CLJU ./CLJUcoding.fasta

bwa-0.7.3a/bwa mem CLJU CLJUsimreadsCodeTrial.single.fastq > CLJUsimreadsCodeTrial.single.sam

Any suggestions?

Thanks and God bless,
Jason

[mastal]

BWA gives no alignment lines in SAM file

Did you get any error messages or other output when you ran BWA?

I think your syntax is not quite right, according to the bwa manual page

http://bio-bwa.sourceforge.net/bwa.shtml

it should be
bwa-0.7.3a/bwa mem ./CLJUcoding.fasta CLJUsimreadsCodeTrial.single.fastq > CLJUsimreadsCodeTrial.single.sam

[jmwhitha]

Hello mastel,

I did not get any error messages. In addition to my CLJUsimreadsCodeTrial_single.sam, I got a CLJU.amb, CLJU.ann, CLJU.bwt, CLJU.pac, and CLJU.sa. My CLJU.amb contains just one problem character according to head command ("3909174 4184 0"). The ann file looks like it contains appropriate text, and the rest of the files are not human readable.

Tried your syntax suggestion and got back: "[E::bwa_idx_load] fail to locate the index files". This message did not occure when I used the syntax in the post above.

Any other suggestions? Thank you very much.

[GenoMax]

Hello mastel,

My CLJU.amb contains just one problem character according to head command ("3909174 4184 0").

What do you mean by "contains one problem character"?

Are there spaces in identifier names in your genome reference file? How large is your reference file? What OS are you running this on?

Can you post a few example lines from your sequence and reference files?

[jmwhitha]

According to http://seqanswers.com/forums/showthread.php?t=20556, the .amb (ambiguous file) contains illegal characters. xied75 intentionally put an R and an S into his fasta file and got back two problem characters: 249240584 1 R and 249240585 1 S. The numbers I assume are coordinates of some sort, and my illegal character is "0".

Yes there are spaces in the multi-fasta file I am using as a reference. According to "grep -c \ CLJUcoding.fasta" there are "4184".

Genome Reference File
"stat -c %s CLJUcoding.fasta" gives "4609956" (bytes) for the file size.
Grabbing a sample from the head using "head -n30 CLJUcoding.fasta" I get:
>lcl|NC_014328.1_cdsid_YP_003778217.1 [gene=dnaA] [protein=chromosomal replication initiator protein] [protein_id=YP_003778217.1] [location=101..1453]
ATGAATGCCCATCCAAAAGAAATATGGGAACAATCTTTAAACATAATAAATGGTGAAATTACTGAAGTAAGCTTTAACACATGGATTAAAAGTATTACTCCTGTATCTATTGAAAATGACACCTTCATATTAAGTGTACCAAATGACCTTACCAAAGGCATATTAACTAGTAAATATAAAAATTTAATAGCTAATGCTCTAAAATTAATTACTTCAAAAAAATACAACATTAAATTTTTAATTGCCTCTGAATCAGAAGAAGCTTTAACATTAGACAATACTAATAAAAGACACAATAAAAATTCCGTATTGGTAAATGATGAAATGTCAACCATGCTAAATCCAAAATATACTTTTGATTCCTTCGTTATAGGTAATAGTAATAGATTCGCTCATGCAGCTTCACTTGCTGTAGCTGAATCACCTTCAAAAGCATATAATCCCCTATTCATATACGGAGGCGTAGGACTAGGCAAAACTCATTTAATGCATGCTATAGGACACTACATATTAAACAATAATAGTAAATCTAAAGTAGTATACGTTTCATCTGAAAAATTTACAAACGAACTTATAAATTCAATAAAAGATGATAAAAATGTAGAATTCAGAAATAAATATAGAAATATAGATGTACTCTTAATAGATGATATACAATTTATTGCAGGTAAAGAAAGAACCCAAGAGGAATTTTTTCATACCTTTAATGCATTATACGAGGCTAATAAACAAATAATTCTATCTAGTGATAGACCACCAAAAGAAATCCCTACATTAGAAGATAGACTTAGATCTAGGTTTGAATGGGGACTTATAGCAGACATTCAACCACCAGACTTTGAAACTAGAATGGCTATATTAAAAAAGAAGGCAGACGTCGAAAATTTAAATATTCCTAATGAAGTAATGGTGTATATAGCTACTAAAATTAAATCCAACATTAGAGAACTTGAAGGTGCGCTAATAAGAATAGTCGCTTTCTCCTCACTTACAAATAAAGAAATAAGTATAGATTTGGCAGTAGAAGCTTTAAAAGATATAATTTCAAGCAAACAATCAAAACAAGTTACTATAGACTTAATACAAGATGTAGTTGCCAACTATTATAACTTAAAAGTAGATGATTTAAAATCTGCAAGAAGAACAAGAAATGTAGCTTTTCCAAGGCAAATAGCTATGTACTTGTGTAGAAAACTTACAGATATGTCTTTGCCAAAAATCGGAGAAGAATTTGGCGGAAGAGATCATACTACCGTAATACATGCTTATGAAAAAATATCAACTAATTTAAAACAAGATGAAAGTCTTCAAAATGCTATAGGCGATTTAACAAAACGACTAAATCAAAATTAA
>lcl|NC_014328.1_cdsid_YP_003778218.1 [gene=dnaN] [protein=DNA polymerase III subunit beta] [protein_id=YP_003778218.1] [location=1710..2813]
ATGAACTTTATATGTACAAAAACAGAATTACAAGAAGCTATTTCAATAGCACAAAAAGCTATCACAGGGAAATCCAGCATGCCAATATTAAATGGTCTACTTATTACAACCTGTAAAAACCAAATTAAATTAACTGGATCAGATATAGACCTCAGTATAGAAACAAAAATAAATGCAGAAATAAAAGAAGAGGGATCCGTAGTAGTTGATTCTAGACTATTTGGAGAAATTATAAGAAAATTACCTAATGACAATATAAATATTTCTACTACAGAAAATAATTCAATAGAAATAATATGTCAAAAATCTAAATTTAATCTAATTCATATGAATGCAGAAGATTTTCCTGAAATACCTAATATAAATGAAAATATTATTTTCTTAATACCTCAAAAAATATTAAAAGATATGATAAAAAGTACTATTTTTGCTGCAGCTCAAGATGAAACTAGACCTATACTTACAGGAATTTTATTTGAAATCAAGGACAAAAAATTAAATTTAGTAGCATTAGACGGATATAGATTAGCTTTAAAATCAGAATATCTTAATACAGAAAA

And for my fastq sequence (just first 10 lines):
jmwhitha@Linux-OptiPlex-755:~$ head CLJUsimreadsCodeTrial_single.fastq
@r1_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
GACTCCTTGCAGCTGGGGAGGTAGAATACCCGATTATTATATTAGTCTAAAAATTGATAATGGTAAGCATTTGTTTTTAATAAATGAATTTCATAATGGG
+
IIIIGDIHIIIIDIIIIHIIIIDIHIIIIEIDFBIIF>HIIEEIIIIIFDEHEGH(IHF#IIHG#@HDGG@BGGBHGHBGD<HBBHIH@D>=BBGG@E>B
@r2_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
TATGGACTTGGTCTAATTTCATGTTGAACTTTATATTCCAGGACTTATTGGTTTCCACATCATTTCCTATAGTAATTCCGCTGTAATTAATTGCATGTAC
+
IDIIIIIIGIHHIIGIGIIIGIIIIIGIIIGDIIIHII@IIIICIIIGI=FIGIIGIGIBEIGHHHIHIE2GHHGHHHH?HIHGB=GIB?#6H>>EG@EC
@r3_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
TAATGGAAAAAAACTACTTATAGATTGTGGTGAGGGAACTCAAGTTAGCTTAAAAATACTTGGATGTAAAATAAAAAATATAGATGTAATTTTATTTACA

Sorry, can't help the line wrapping.

What do you think?

Thank you again respondents.

[jmwhitha]

Or actually, lack of wrapping.

[GenoMax]

I was able to generate a sam file (attached) using the test sequences you had included in previous post.

Is the bwa you are trying to use known to work correctly? Did you download and compile it yourself?

[jmwhitha]

Oh, great!

Yes, I downloaded and compiled it, but had some issues. See http://seqanswers.com/forums/showthread.php?t=29498

What version of bwa are you using? I am using 0.7.3a

Thank you so much!

[GenoMax]

Oh, great!

Yes, I downloaded and compiled it, but had some issues. See http://seqanswers.com/forums/showthread.php?t=29498

What version of bwa are you using? I am using 0.7.3a

Thank you so much!

I did use 0.7.3a.

I think there is something wrong with your copy of bwa. You are not going to go far until that is fixed.

I assume you are the "sys admin" for this machine (since it appears to be a desktop). What flavor of linux are you running (is it running natively or as a virtual machine)?

I just noticed that there is bwa v. 0.7.4. out. Give that a shot to see if you fare better with the compilation.

[jmwhitha]

I used the following command to get the newest version of bwa from sourceforge:
wget http://sourceforge.net/projects/bio-...d?source=files -O bwa.tar.bz2

Then I opened the tarball and went into the directory with:
tar -xjf bwa.tar.bz2
cd bwa-0.7.4

This is what happens when I execute "make":

gcc -c -g -Wall -O2 -DHAVE_PTHREAD utils.c -o utils.o
gcc -c -g -Wall -O2 -DHAVE_PTHREAD kstring.c -o kstring.o
gcc -c -g -Wall -O2 -DHAVE_PTHREAD ksw.c -o ksw.o
In file included from ksw.c:28:0:
/usr/lib/gcc/i686-linux-gnu/4.7/include/emmintrin.h:32:3: error: #error "SSE2 instruction set not enabled"
ksw.c:44:2: error: unknown type name ‘__m128i’
ksw.c: In function ‘ksw_qinit’:
ksw.c:67:11: error: ‘__m128i’ undeclared (first use in this function)
ksw.c:67:11: note: each undeclared identifier is reported only once for each function it appears in
ksw.c:67:19: error: expected expression before ‘)’ token
ksw.c: In function ‘ksw_u8’:
ksw.c:110:2: error: unknown type name ‘__m128i’
ksw.c:126:2: warning: implicit declaration of function ‘_mm_set1_epi32’ [-Wimplicit-function-declaration]
ksw.c:127:2: warning: implicit declaration of function ‘_mm_set1_epi8’ [-Wimplicit-function-declaration]
ksw.c:133:3: warning: implicit declaration of function ‘_mm_store_si128’ [-Wimplicit-function-declaration]
ksw.c:140:3: error: unknown type name ‘__m128i’
ksw.c:141:3: warning: implicit declaration of function ‘_mm_load_si128’ [-Wimplicit-function-declaration]
ksw.c:142:3: warning: implicit declaration of function ‘_mm_slli_si128’ [-Wimplicit-function-declaration]
ksw.c:150:4: warning: implicit declaration of function ‘_mm_adds_epu8’ [-Wimplicit-function-declaration]
ksw.c:151:4: warning: implicit declaration of function ‘_mm_subs_epu8’ [-Wimplicit-function-declaration]
ksw.c:153:4: warning: implicit declaration of function ‘_mm_max_epu8’ [-Wimplicit-function-declaration]
ksw.c:177:5: warning: implicit declaration of function ‘_mm_movemask_epi8’ [-Wimplicit-function-declaration]
ksw.c:177:5: warning: implicit declaration of function ‘_mm_cmpeq_epi8’ [-Wimplicit-function-declaration]
ksw.c:183:3: warning: implicit declaration of function ‘_mm_srli_si128’ [-Wimplicit-function-declaration]
ksw.c:183:3: warning: implicit declaration of function ‘_mm_extract_epi16’ [-Wimplicit-function-declaration]
ksw.c: In function ‘ksw_i16’:
ksw.c:228:2: error: unknown type name ‘__m128i’
ksw.c:244:2: warning: implicit declaration of function ‘_mm_set1_epi16’ [-Wimplicit-function-declaration]
ksw.c:256:3: error: unknown type name ‘__m128i’
ksw.c:260:4: warning: implicit declaration of function ‘_mm_adds_epi16’ [-Wimplicit-function-declaration]
ksw.c:262:4: warning: implicit declaration of function ‘_mm_max_epi16’ [-Wimplicit-function-declaration]
ksw.c:266:4: warning: implicit declaration of function ‘_mm_subs_epu16’ [-Wimplicit-function-declaration]
ksw.c:282:5: warning: implicit declaration of function ‘_mm_cmpgt_epi16’ [-Wimplicit-function-declaration]
make: *** [ksw.o] Error 1

Do you know why this is happening?

[jmwhitha]

Sorry, I forgot to answer your other questions.

Yes, I am. Desktop. Running natively.

[GenoMax]

Yes, I am. Desktop. Running natively.

Can you post the output of:

uname -a

I am wondering what linux distribution of a recent vintage does not come with a functional compiler? What exact distro of linux are you using?

[jmwhitha]

Linux Linux-OptiPlex-755 3.5.0-27-generic #46-Ubuntu SMP Mon Mar 25 20:00:05 UTC 2013 i686 i686 i686 GNU/Linux

I hope that is the case. If it is, what compiler should I get? I have the latest version of protobuf-compiler according to apt-get.

[jmwhitha]

I also did the build-essentials.

[GenoMax]

I wonder if you have some kind of software conflict with compilers.

sudo apt-get install gcc

should have been all that was needed