Ktu, please re-read this thread carefully. The sequencing primers has already been posted by pmiguel. The Illumina provided primers are actually a pool of several different primers, but their characteristics are all fairly similar.
Unconfigured Ad
Collapse
X
-
thank you for your answer but i'm using nextera DNA kit for my library and the sequences of the adaptors don't match with the sequencing primers posted by pmiguel.Originally posted by kcchan View PostKtu, please re-read this thread carefully. The sequencing primers has already been posted by pmiguel. The Illumina provided primers are actually a pool of several different primers, but their characteristics are all fairly similar.
In the illumina's letter, they give those informations but nothing about primers. Maybe i miss something
Nextera® transposase sequences (FC-121-1031, FC-121-1030)
5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
(a) Read 1 -->
5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
(d) Read 2 -->
Nextera® Index Kit - PCR primers (FC-121-1012, FC-121-1011)
5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
(c) i5 Index read -->
5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
<-- i7 Index read (b)
Comment
-
-
I may have posted adapter sequences, but for the most part Illumina refuses to reveal their primer sequences. My guess is that is because, like Fluidigm they rely on LNA, or something similar to increase the Tm of their primers for the MiSeq. And someone had sworn them to secrecy about that. (Like that was a condition of their acquiring a license to use that technology.)Originally posted by kcchan View PostKtu, please re-read this thread carefully. The sequencing primers has already been posted by pmiguel. The Illumina provided primers are actually a pool of several different primers, but their characteristics are all fairly similar.
That said, the have a technical doc that specifies the maximum temps an annealed primer would be subjected to during cycling. And I don't think there is a down-side to just cranking your Tm as high as possible. Either using LNAs or long primers. Remember this is not like Sanger cycle sequencing -- the primers are not re-annealing during the sequencing process.
--
Phillip
Comment
-
-
I am using custom primers on a low complexity library. I used positions 18, 19 and 20 to put in the primers. Will the system read the PhiX clones (i.e. are the standard primers mixed into the run mix) or do I need to mix my custom primers into a different position on the block?
Comment
-
-
To sequnce clusters with custom primers and standard TruSeq primers (e.g PhiX control) you have to mix all the primers for each read together. You do this by adding your custom primers into the reagent location containg the standard primers. The MiSeq documentation and your FAS can help you with the neccessary volumes/concentrations.Originally posted by NWBiotech View PostI am using custom primers on a low complexity library. I used positions 18, 19 and 20 to put in the primers. Will the system read the PhiX clones (i.e. are the standard primers mixed into the run mix) or do I need to mix my custom primers into a different position on the block?
Comment
-
-
Good morning,
I'm currently using Nextera XT for my transposons' library. However during the PCR amplification, I'm using one custom primer and the primer P7 from the kit in order to select all the fragments with the transposon insertions sites.
Here are the sequence of the primers used during the amplification:
Custom primer amplification forward: 5' AATGATACGGCGACCACCGAGCATGCAAGCTTCAGGGTTGAGATGTG3'
LENGTH:47 GC CONTENT:53.2 %MELT TEMP:70.5 ºC
P7 Primer amplification reverse: 5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG 3'
Then i follow the differents steps of the Nextera XT DNA sample preparation guide
For the sequencing, i also design a custom sequencing primer for the read 1 which recognize the sequence of the transposon.
Here is the sequence of my custom primer sequencing:
Primer Sequencing: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA
LENGTH:33GC CONTENT:51.5 %MELT TEMP:65.6 ºC
My problem: The results after the run (50 cycles single read)are completely wrong. I don't have right sequences. For example i get only a read of A or C. Although, the index read are perfect. So i think my sequence primer is wrong but i don't understand why. I respect the length, GC content and the melt temperature.
Questions : Are my custom primers correct? Are there others properties for the custom primer?
Thanking you in anticipation,
Comment
-
-
Hi Ktu,
I'm curious as to why you chose to use Nextera in conjunction with your own PCR primers. Wouldn't it have been simpler to just make an amplicon library instead?
Anyway, I think the problem you're facing is that the primer sequences are incorrect. The P5 adapter sequence is wrong at one of the bases. Furthermore, your sequencing primer bleeds into the P5 adapter and has two extra bases than your PCR primer. Those factors could have been enough to mess up the hybridization conditions for the primer and result in poor sequencing. I would suggest re-designing your PCR primers so that it uses correct P5 adapter sequence and 7 bases worth of padding before your primer sequence. You'll also have to shift your sequencing primers so that it doesn't overlap the P5 adapter sequence. You can use the padding region if you need some more bases to get the Tm to around 65°C if necessary.
Comment
-
-
Hi,Originally posted by kcchan View PostHi Ktu,
I'm curious as to why you chose to use Nextera in conjunction with your own PCR primers. Wouldn't it have been simpler to just make an amplicon library instead?
Anyway, I think the problem you're facing is that the primer sequences are incorrect. The P5 adapter sequence is wrong at one of the bases. Furthermore, your sequencing primer bleeds into the P5 adapter and has two extra bases than your PCR primer. Those factors could have been enough to mess up the hybridization conditions for the primer and result in poor sequencing. I would suggest re-designing your PCR primers so that it uses correct P5 adapter sequence and 7 bases worth of padding before your primer sequence. You'll also have to shift your sequencing primers so that it doesn't overlap the P5 adapter sequence. You can use the padding region if you need some more bases to get the Tm to around 65°C if necessary.
Thank you for your answer.
I'm using nextera because it is faster to make a library.
When i do the amplification PCR. i'm not using the primer P5 given by the kit. So i don't have the P5 adapter.I am only using my custom primer for the amplification so i can select all the fragments with the insertion site of the transposon.
At the end, i have 1)the sequence for clusters (AATGATACGGCGACCACCGA) 2) the insertion site (GCATGCAAGCTTCAGGGTTGAGATGTG ) 3)ADN that i want to sequence 4) index 5) P7 adaptor.
The sequencing primer has 2 more bases corresponding to the 2 next bases of the transposon sequence. It was added just for the Tm and the %GC.This primer recognizes the insertion site (2).
I dont understand how it can interact with the P5 adaptor because my sequencing primer has the same sequence than the sequence used is PCR (2)
Comment
-
-
Hi Ktu,
Are you using a 2-step PCR approach, where you append Read 1/2 sequences along with the transposome sequence to your locus gene primer, and then during the 2nd PCR you use the NExtera index kit to add sequencing adapters (P5/P7 seqeunces+indexes) to your samples?
How is the complexity of your sample? If it's low, you might need to add some Ns between your primer and the transposome sequences to increase the complexity of your sample. My plan is to do 2 PCR rounds:
PCR1: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[gene specific primer]-3' + 5'-GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG-[gene specific primer]-3'
PCR2: Nextera kit where PCR primer1-{i5}-5'-Adapter + PCR primer 2-{i7}-3'-Adapter
Did you get positive unique bands on gels?
I'd be curious to know what went wrong with your run...
Comment
-
-
Hi,Originally posted by lotijeo View PostHi Ktu,
Are you using a 2-step PCR approach, where you append Read 1/2 sequences along with the transposome sequence to your locus gene primer, and then during the 2nd PCR you use the NExtera index kit to add sequencing adapters (P5/P7 seqeunces+indexes) to your samples?
How is the complexity of your sample? If it's low, you might need to add some Ns between your primer and the transposome sequences to increase the complexity of your sample. My plan is to do 2 PCR rounds:
PCR1: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[gene specific primer]-3' + 5'-GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG-[gene specific primer]-3'
PCR2: Nextera kit where PCR primer1-{i5}-5'-Adapter + PCR primer 2-{i7}-3'-Adapter
Did you get positive unique bands on gels?
I'd be curious to know what went wrong with your run...
Actually i did in parallel two experience:
1) Two PCR(12+12 cycles):
a- PCR with the kit index to increase the fragments' number that i call PCR index. Using P5/P7 primers. I got for this experience only one band
b- PCR with my custom primer with the clustering primer-my gene specific primer and P7 primer that i call PCR selection
So i have AATGATACGGCGACCACCGAGCATGCAAGCTTCAGGGTTGAGATGTGDNAINDEX P7
I got for this experience a smire in agarose gel. It is normal because i target my gene which is cut randomly during the tagmentation step. Meaning that the sequence that i target can be at the beginning, the middle or the end of the fragment.
2) One PCR (30 cycles):
- PCR selection : custom primer + P7 primer
I don't need to do a PCR index because i am sequencing with a specific primer who recognizes my gene GCATGCAAGCTTCAGGGTTGAGATGTG and not P5.
My sequencing primer is like this: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA
I add two nucleotide TA at 3' end because of the TM and i overlap the clustering primer. I think the problem is here.
If i use these primers, i'm afraid that there will be competition between transposase sequence TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and my gene specific primer. Because the transposase sequence correspond to the first nucleotides and my gene like i said above can be anywhere.Originally posted by lotijeo View PostPCR1: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[gene specific primer]-3' + 5'-GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG-[gene specific primer]-3'
The gene sequence is not directly next to the transposase sequence.
Comment
-
-
Hi Ktu,
I think your problem is the low complexity of your library. From what you describe, I guess your custom sequencing primer was designed such that it will sequence a bit of your transposon end then continue to sequence the DNA insertion site.
Sequencing primer: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA
Transposon sequence: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA taagagacagctg
(I use TnLoxp53 sequence as an example here)
This means that all reads of your library begin with "taagagacagctg" which creates huge problem with the software trying to identify clusters for base calling. Have you considered using a mix of sequencing primers to increase the complexity of your library?
Comment
-
-
Hi,Originally posted by kinurev View PostThis means that all reads of your library begin with "taagagacagctg" which creates huge problem with the software trying to identify clusters for base calling. Have you considered using a mix of sequencing primers to increase the complexity of your library?
It is exactly what i want to do. But i don't understand what is the probleme with the software.
I am working on two differents transposon so i have two sequencing primers.
Comment
-
-
This is no longer the case for the MiSeq. The v2.2 MCS software has completely solved this instrument issue. You just need to spike in 5% or more of a high complexity library. That's it. Problem solved.Originally posted by kinurev View PostHi Ktu,
I think your problem is the low complexity of your library. From what you describe, I guess your custom sequencing primer was designed such that it will sequence a bit of your transposon end then continue to sequence the DNA insertion site.
Sequencing primer: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA
Transposon sequence: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA taagagacagctg
(I use TnLoxp53 sequence as an example here)
This means that all reads of your library begin with "taagagacagctg" which creates huge problem with the software trying to identify clusters for base calling.
Of course, there is now a year or more worth of manuals, publications and word of mouth telling us and providing many sorts of insane work arounds to what always was an instrument/software issue. So it will take some time for the word to get out that these are not necessary for the MiSeq.
Are they necessary for any Illumina sequencer? Well, most of the issues caused by "the issue" we are discussing are said to go away if one uses a control lane on a flow cell. So, maybe not?
--
Phillip
Comment
-
-
Can you give a little more detail on the software changes that improve runs with low-complexity libraries (assuming you spike in >= 5% high-complexity DNA)? Or point to the thread that discusses this change?Originally posted by pmiguel View PostThis is no longer the case for the MiSeq. The v2.2 MCS software has completely solved this instrument issue. You just need to spike in 5% or more of a high complexity library. That's it. Problem solved.
Of course, there is now a year or more worth of manuals, publications and word of mouth telling us and providing many sorts of insane work arounds to what always was an instrument/software issue. So it will take some time for the word to get out that these are not necessary for the MiSeq.
Are they necessary for any Illumina sequencer? Well, most of the issues caused by "the issue" we are discussing are said to go away if one uses a control lane on a flow cell. So, maybe not?
--
Phillip
Based on the software release notes, I am guessing it has something to do with the color matrix estimation method changing? But I do not have enough expertise on these methods to be sure.
thanks!
Comment
-
Latest Articles
Collapse
-
by SEQadmin2
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...-
Channel: Articles
07-09-2026, 11:10 AM -
-
by SEQadmin2
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...-
Channel: Articles
07-08-2026, 05:17 AM -
-
by GATTACATLove this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
-
Channel: Articles
07-01-2026, 11:43 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Yesterday, 10:26 AM
|
0 responses
13 views
0 reactions
|
Last Post
by SEQadmin2
Yesterday, 10:26 AM
|
||
|
Started by SEQadmin2, 07-09-2026, 10:04 AM
|
0 responses
26 views
0 reactions
|
Last Post
by SEQadmin2
07-09-2026, 10:04 AM
|
||
|
Started by SEQadmin2, 07-08-2026, 10:08 AM
|
0 responses
16 views
0 reactions
|
Last Post
by SEQadmin2
07-08-2026, 10:08 AM
|
||
|
Started by SEQadmin2, 07-07-2026, 11:05 AM
|
0 responses
33 views
0 reactions
|
Last Post
by SEQadmin2
07-07-2026, 11:05 AM
|
Comment