Solexa/helicos

[[email protected]]

Hi all,

I am graduate student from New York working on a project related to assembler. In order to get idea of how things work in assembler, I download velvet and i am trying to run it on different data types such as ABI solid, Helicos and Solexa.
I ran ABI solid on velvet and it worked. However, I didn't find solexa and Helicos data from the net. Could anyone upload some test data w.r.t Helicos, Solexa or point me to the right place from where i can download some sample data to run it in velvet.

Thanks,
Chandu

[Xi Wang]

Hi all,

I am graduate student from New York working on a project related to assembler. In order to get idea of how things work in assembler, I download velvet and i am trying to run it on different data types such as ABI solid, Helicos and Solexa.
I ran ABI solid on velvet and it worked. However, I didn't find solexa and Helicos data from the net. Could anyone upload some test data w.r.t Helicos, Solexa or point me to the right place from where i can download some sample data to run it in velvet.

Thanks,
Chandu

There are lots of resources on the website of NCBI:

http://www.ncbi.nlm.nih.gov/sra/

The Sequence Read Archive (SRA) stores sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome Analyzer®, Applied Biosystems SOLiD® System, Helicos Heliscope®, and others.

For example, you can get the sequencing data of an illumina run through:
ftp://ftp.ncbi.nlm.nih.gov/sra/static/SRX003/SRX003935/

Hope this info helps.
Xi

[[email protected]]

Regarding change of file formats..!!

Thanks for the reply..The solexa data was helpful..

On a separate note, I have some more questions..

1. I couldn't find helicos data in the above links...Could you please help with this..??
2. One more question is regarding the change of file formats (from solexa to fasta, from helicos to fasta).. Are there any scripts or tools for this? If yes, could you please point me to those resources or links..??

Thanks,
Chandu

[steven]

Chandu,
You'll find Helicos datasets here (just need to open an account) or there. It's already in fasta format.
cheers,
s.

[[email protected]]

Steven,

Thanks a lot for the helicos data..

I have some more data which has to be converted to fasta format..So I need a converter or some scripts which basically converts from different formats to fasta format.. could you please help me on this conversion part..??

Thanks,
Chandu

[Xi Wang]

Steven,

Thanks a lot for the helicos data..

I have some more data which has to be converted to fasta format..So I need a converter or some scripts which basically converts from different formats to fasta format.. could you please help me on this conversion part..??

Thanks,
Chandu

What is the format of the data you already have? Could you please paste a head of the data here?

[steven]

If the answer is not in a previous threads (like this one or this one), i would suggest to open a new thread with a relevant title, specifying the formats you want to convert into fasta.
cheers,
s.

[[email protected]]

@xi

This is a first 10 lines of fastq file....I downloaded it from the net..this has to converted to fasta file..

@SRR015348.1 HWUSI-BETA8_3:8:1:441:264 length=32
AACGGACCCCTTCACTCTGGCCTCCTGTAGGT
+SRR015348.1 HWUSI-BETA8_3:8:1:441:264 length=32
YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYTQ
@SRR015348.2 HWUSI-BETA8_3:8:1:861:561 length=32
ATCATCTCTGCCCCCTCTGCTGATGCCCCCAT
+SRR015348.2 HWUSI-BETA8_3:8:1:861:561 length=32
YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYQQ
@SRR015348.3 HWUSI-BETA8_3:8:1:687:253 length=32
ACCTGCAGAGGCTCATCTTTGCAGGCAAGCAG
..........................................................................................

@Steven

I tried running the script which u mentioned with the following command
"perl script.pl SRR015348.fastq SRR015348.fasta"

it throws error saying that "No such file or directory at script.pl line 3, <> line 10600168"..

Iam giving the path correctly..But still it showing up the above error after executing the script for some 30-40 secs...


Thanks,
Chandu

[Xi Wang]

Hi Chandu,

i find there is a script to convert fastq to fasta:

http://www.ringtail.tsl.ac.uk/david-studholme/scripts/fastq2fasta.pl

i think you can check this script first. hope it works.

[[email protected]]

@Xi

Thanks for the script..

I tried running the script using the following command..

perl fastq2fasta.pl xyz.fastq

It ran for couple of minutes.... and terminated successfully..

My question is .. Will it generate a new fasta file from fastq file..?? or will it convert fastq to fasta itself..??

I tried checking old and new fastq files after running the script...there is no difference..

And one more doubt is how can i identify fastq and fasta files..??

Please help on this..

Thanks,
Chandu

[ECO]

@Xi

Thanks for the script..

I tried running the script using the following command..

perl fastq2fasta.pl xyz.fastq

It ran for couple of minutes.... and terminated successfully..

My question is .. Will it generate a new fasta file from fastq file..?? or will it convert fastq to fasta itself..??

I tried checking old and new fastq files after running the script...there is no difference..

And one more doubt is how can i identify fastq and fasta files..??

Please help on this..

Thanks,
Chandu

You need to capture its output in a file, as it's just printing to stdout. Try this:

perl fastq2fasta.pl xyz.fastq > xyz.fasta

[[email protected]]

I didn't notice that..

Thanks a lot

Chandu

[sundar suku]

Help me on velvet

Hi all,

I am having some doubts regarding velvet :

I am just a beginner to velvet. I couldn't able to understand of differentiate shortPaired,short2,longPaired.

What are all the parameters are neccessary to run properly?

I would be wonder if any one of u peoples help me in this,

Thanks all..............

[labunit]

I don't know wether there is still any demand to know an easy way to convert from fastq to fasta but here it is anyway:

egrep -A 1 "^@" file.fastq | tr "@" ">" | egrep -v "\-\-" > file.fasta

The first part greps the lines beginning with @ plus the next line (-A 1) which is the line containing the read. The next part translates the "@" into an ">" to comply with the fasta format. The final part greps (-v: inverted grep) only the relevant lines for the output file. Without the last part annoying lines containing "--" would appear in the fasta-file.