Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • eligar97
    Junior Member
    • Jul 2013
    • 2

    #1

    Viral Alignment- ViralFusionSeq

    Hi everyone. I am a high school intern and I am working in aligning viral genomes to RNAseq data. I am very new to bioinformatics, and am still learning how to manage alignment software. I have been using the software ViralFusionSeq to locate viral integration sites. Unfortunately, I am having major technical difficulties. I am constantly getting the same error message when I try to run the sample dataset. I have installed all of the cpan modules and 3rd party software, but I still get this error:

    Thread 1 terminated abnormally: main=HASH(0x2b212422a238) at viral.fusion.pl line 621.
    Thread 2 terminated abnormally: main=HASH(0x2b212822a240) at viral.fusion.pl line 622.
    Use of uninitialized value $ReturnData[0] in join or string at viral.fusion.pl
    line 624 (#1)
    (W uninitialized) An undefined value was used as if it were already
    defined. It was interpreted as a "" or a 0, but maybe it was a mistake.
    To suppress this warning assign a defined value to your variables.

    To help you figure out what was undefined, perl will try to tell you the
    name of the variable (if any) that was undefined. In some cases it cannot
    do this, so it also tells you what operation you used the undefined value
    in. Note, however, that perl optimizes your program and the operation
    displayed in the warning may not necessarily appear literally in your
    program. For example, "that $foo" is usually optimized into "that "
    . $foo, and the warning will refer to the concatenation (.) operator,
    even though there is no . in your program.

    Use of uninitialized value $ReturnData2[0] in join or string at viral.fusion.pl
    line 627 (#1)


    Does anyone who has used this software have any ideas as to why I have this error?

    Thanks for your help.
  • marcowanger
    Senior Member
    • Dec 2008
    • 273

    #2
    Hi eligar97,

    Which version fo VFS did you download?

    Are you running VFS on Ubuntu system, or others?

    Marco
    Marco

    Comment

    • eligar97
      Junior Member
      • Jul 2013
      • 2

      #3
      I'm using the December 7th, 2012 version. Its being run on Ubuntu.

      Comment

      • marcowanger
        Senior Member
        • Dec 2008
        • 273

        #4
        Hi eli, did the single thread version of VFS works?
        Marco

        Comment

        • akhattri
          Junior Member
          • Mar 2011
          • 8

          #5
          hi there, I am also getting somewhat similar error while running VFS (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.

          Code:
          [COLOR="Teal"][B][SIZE="4"]Command[/SIZE][/B][/COLOR]
          perl 2.run.example.dataset.pl
          
          [FONT="Times New Roman"][B]The file "2.run.example.dataset.pl" has a the following command:[/B][/FONT]
          perl viral.fusion.pl --config vfs.conf --insertSIZE 350 HKCI5a CL7R_1_VFS.fq CL7R_2_VFS.fq
          
          [FONT="Times New Roman"][B]Both the fq files are included in vfs and I edited vfs.conf file to include the path of 3rd party software[/B].[/FONT]
          
          
          [COLOR="Teal"][B][SIZE="4"]Error 1[/SIZE][/B][/COLOR]
          Hashing CL7R_1_VFS.dynamic.min35.fq.gz
          Hashing CL7R_2_VFS.dynamic.min35.fq.gz
          Use of uninitialized value in concatenation (.) or string at
          	/data3/users/arun/Apps/vfs/include/RPmethod.pm line 268 (#1)
              (W uninitialized) An undefined value was used as if it were already
              defined.  It was interpreted as a "" or a 0, but maybe it was a mistake.
              To suppress this warning assign a defined value to your variables.
              
              To help you figure out what was undefined, perl tells you what operation
              you used the undefined value in.  Note, however, that perl optimizes your
              program and the operation displayed in the warning may not necessarily
              appear literally in your program.  For example, "that $foo" is
              usually optimized into "that " . $foo, and the warning will refer to
              the concatenation (.) operator, even though there is no . in your
              program.
              
          Hashing vfs_dev.HKCI5a.4h_map.fq
          Entering Essential::tx_targeted_assembly.
          Skipped Insert Size estimation. Supplied insert size: 350
          Essential::ssake_reads_prep
          Assuming fasta file
          Hashing vfs_dev.HKCI5a.RPm.out_2.fa
          Processing vfs_dev.HKCI5a.RPm.out_1.fa and vfs_dev.HKCI5a.RPm.out_2.fa
          Use of uninitialized value in pattern match (m//) at
          	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 2 (#1)
          Use of uninitialized value in concatenation (.) or string at
          	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 2 (#1)
          Use of uninitialized value in pattern match (m//) at
          	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 4 (#1)
          Use of uninitialized value in concatenation (.) or string at
          	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 4 (#1)
           
          
          [FONT="Times New Roman"][B] --------------continued to even no of lines (6,8,10,12,14...36)--------------[/B][/FONT]
          
          	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 38 (#1)
          Use of uninitialized value in concatenation (.) or string at
          	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 38 (#1)
          
          
          
          [COLOR="Teal"][B][SIZE="4"]Error 2: SSAKE[/SIZE][/B][/COLOR]
          
          Running: /data3/users/arun/Apps/ssake_v3-8/SSAKE [v3.8]
          -f vfs_dev.HKCI5a.RPm.plus.vicinity.CS_FnR.ssake.in
          -s vfs_dev.HKCI5a.CSm.out.fullread.fa
          	-i 0
          -h 0
          -w 1
          -m 20
          -o 3
          -r 0.9
          -t 0
          -z 100
          -p 1
          -e 0.75
          -k 4
          -a 0.5
          -x 20
          Unpaired reads (optional) -g no-g
          Scaffolds: vfs_dev.HKCI5a.targeted.assembly.sensitive.scaffolds
          Merged contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.mergedcontigs
          Pairing issues: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_issues
          Pairing distance distribution: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_distribution.csv
          
          Contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.contigs
          Singlets: vfs_dev.HKCI5a.targeted.assembly.sensitive.singlets
          
          Excluded reads: vfs_dev.HKCI5a.targeted.assembly.sensitive.short
          Log: vfs_dev.HKCI5a.targeted.assembly.sensitive.log
          
          =>Reading sequences initiated Thu Jan  2 14:45:44 CST 2014
          Sequence reads loaded:
          616Input error at line #618: The sequence "0:" is not in the right format for paired-end reads  -- Fatal
          Make sure your input is in the form (input sequences can be of variable lengths):
          
          >test
          GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT
          
          Where : separates paired reads.  Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.
          mv: cannot stat `vfs_dev.HKCI5a_temp/*.targeted.*.contigs': No such file or directory
          Number of log files deleted:  0
          Last edited by akhattri; 01-03-2014, 05:18 PM. Reason: included the command used to run the vfs

          Comment

          • swbarnes2
            Senior Member
            • May 2008
            • 910

            #6
            Why don't you start by including a snippet from your input files, and the exact command line you used.

            Comment

            • akhattri
              Junior Member
              • Mar 2011
              • 8

              #7
              hi there, As swbarnes2 said, I've included the command ,in my question above , that I used to run vfs.
              I used the same test files provided with the software (vfs), hence, I've not included the snippets.

              Let me know if you need any other information.

              Thanks

              Comment

              • marcowanger
                Senior Member
                • Dec 2008
                • 273

                #8
                akhattri, I am looking at your problem now.

                Originally posted by akhattri View Post
                hi there, As swbarnes2 said, I've included the command ,in my question above , that I used to run vfs.
                I used the same test files provided with the software (vfs), hence, I've not included the snippets.

                Let me know if you need any other information.

                Thanks
                Marco

                Comment

                • IBseq
                  Member
                  • Jul 2012
                  • 56

                  #9
                  hi everyone,
                  hope I'm in the right place!

                  I need to use vfs to detect fusions in my sequenced samples.

                  I am a very beginner on unix, thus im havng problems to get started:
                  I have downloaded vfs version 1289
                  I have downloaded all third party programs and hopefully everything i need to run it...

                  but!
                  I seem i might have missed the perl script to run the program...

                  any help?

                  thanks,
                  ib

                  Comment

                  • marcowanger
                    Senior Member
                    • Dec 2008
                    • 273

                    #10
                    Dear IBseq,

                    First you need to run 1.VFS.sys.check.pl to see if the dependencies can be called successfully. If you have already done that, then it is nice.

                    Then you either run viral.fusion.pl with your config file, or "2.run.example.dataset.pl" to test VFS on the example data supplied with the package.

                    Hope it helps.

                    Marco
                    Marco

                    Comment

                    • IBseq
                      Member
                      • Jul 2012
                      • 56

                      #11
                      Originally posted by marcowanger View Post
                      Dear IBseq,

                      First you need to run 1.VFS.sys.check.pl to see if the dependencies can be called successfully. If you have already done that, then it is nice.

                      Then you either run viral.fusion.pl with your config file, or "2.run.example.dataset.pl" to test VFS on the example data supplied with the package.

                      Hope it helps.

                      Marco

                      Thanks Marco,
                      I have run 1.VFS.sys.check.pl but where can I see the output?
                      No error came up, so shall I assume everything is correctly installed with correct dependencies?

                      Thanks very much,
                      ib

                      Comment

                      • IBseq
                        Member
                        • Jul 2012
                        • 56

                        #12
                        Hello everyone,
                        quick question about vfs: to save my viral genome of interest, is is enough to use the fasta file from NCBI website (http://www.ncbi.nlm.nih.gov/nuccore/...9?report=fasta) and replace it with the hbv4.fa? i have noticed that the viral genome that comes with the package is different..

                        any suggestion?
                        thanks,
                        ib

                        Comment

                        • IBseq
                          Member
                          • Jul 2012
                          • 56

                          #13
                          I meant different as it contains different lines. Not sure if this is specific with the hbv4 genome (which i dont know much about!)

                          Comment

                          • IBseq
                            Member
                            • Jul 2012
                            • 56

                            #14
                            vfs running

                            hi everyone
                            (if anyone is there!!!)

                            I run the vfs example 1.VFS.sys.check.pl and got nothing. this is the report after i submitted the job:

                            Make sure BWA is installed and is available in PATH
                            List::Util qw( min max ) loaded: OK
                            Bio:B::Sam loaded: OK
                            Bio::SeqIO loaded: OK
                            Bio::SearchIO loaded: OK
                            Bio:B::Sam loaded: OK
                            AppConfig fails loading.
                            AppConfig::Getopt fails loading.
                            Cwd loaded: OK
                            Exporter loaded: OK
                            File::Which fails loading.
                            FileHandle loaded: OK
                            FindBin loaded: OK
                            Pod::Usage loaded: OK
                            Statistics:escriptive loaded: OK
                            File::Copy loaded: OK
                            PerlIO::gzip fails loading.
                            Please check AppConfig is installed properly
                            Please check AppConfig::Getopt is installed properly
                            Please check File::Which is installed properly
                            Please check PerlIO::gzip is installed properly


                            please any help!!!!

                            thanks,
                            ib

                            Comment

                            Latest Articles

                            Collapse

                            • SEQadmin2
                              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                              by SEQadmin2



                              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                              Despite this, “CRISPR helped turn genome editing from a specialized technique into
                              ...
                              07-31-2026, 11:01 AM
                            • SEQadmin2
                              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                              by SEQadmin2


                              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                              The systematic characterization of the human proteome has
                              ...
                              07-20-2026, 11:48 AM
                            • SEQadmin2
                              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                              by SEQadmin2



                              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                              ...
                              07-09-2026, 11:10 AM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by SEQadmin2, Today, 07:41 AM
                            0 responses
                            9 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 08-03-2026, 10:13 AM
                            0 responses
                            25 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-31-2026, 02:55 AM
                            0 responses
                            38 views
                            0 reactions
                            Last Post SEQadmin2  
                            Started by SEQadmin2, 07-24-2026, 12:17 PM
                            0 responses
                            25 views
                            0 reactions
                            Last Post SEQadmin2  
                            Working...