Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • fahmida
    Member
    • Aug 2010
    • 54

    #1

    strange FastQC kmer plot even after trimming

    Hi,
    I've the attached strange FastQC kmer plot even after adpter and quality trimming. The data is from 400bp PE library from GAII. I've used trimmomatic to trim the TruSeq adapter.
    Code:
    GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG
    As suggested by many other posts not to worry too much about things like this. However, I am coming back to this only after getting a highly fragmented denovo assembly of a large genome. I understand that denovo assembly can be like that for many reasons, however, just to make sure I've high quality reads to supply to assembler and not to mention the plot looks Ugly.
    Thanks for any suggestions.
    Attached Files
  • Wallysb01
    Senior Member
    • Feb 2011
    • 286

    #2
    Oh, for de novo assembly you should definitely worry about that (if you were just mapping reads to a genome, it likely wouldn't matter). Those 5-mers are being generated from two dinucleotide repeats (just in different frames and strands). That is going to screw up your assembly if you have very many of them infiltrating your reads, which we can't tell for that plot, but its just relative to the highest abundant k-mer.

    Are you sure you put in the correct adapter for trimming. Just the TruSeq adapter is often not correct. But rather you need some set of indexed adapters, PCR primers, etc. I generally give Trimmomatic a pretty long list of every adapter/primer set that was used in the whole group of library preps being sequenced, just to be sure. After your assemblies, you'll find adapter/primer sequence of all kinds of stuff if you don't.

    Comment

    • Wallysb01
      Senior Member
      • Feb 2011
      • 286

      #3
      Here are two K-mer plots before (bottom) and after (top and that CCCCC repeat is very much lower than the spikes you see in the bottom window) aggressive trimming with trimmomatic (including a quality trim) and overlapping with flash (do your 150bp reads overlap?). Here is the adapter file I went with too, as you can see it was a bit of the kitchen sink.
      Click image for larger version

Name:	kmer_profiles.png
Views:	1
Size:	19.5 KB
ID:	304269

      Click image for larger version

Name:	kmer_profiles_1.png
Views:	1
Size:	64.5 KB
ID:	304270

      Adapters.txt

      Comment

      • fahmida
        Member
        • Aug 2010
        • 54

        #4
        Hi Wallysb01,

        Thanks for your reply. I haven't explored the overlapping reads.
        I've used your adapters and it seems most of those kmers are still having fun out there.
        Also for your info, here is the trimmomatic command I used:
        Code:
        java -classpath trimmomatic-0.30.jar org.usadellab.trimmomatic.TrimmomaticPE -threads 16 -phred33 ../lane2_NoIndex_L002_R1_001_val_1.fq ../lane2_NoIndex_L002_R2_001_val_2.fq paired21.fq unpaired21.fq paired22.fq unpaired22.fq ILLUMINACLIP:Adapters.txt:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:30 MINLEN:50
        Attached Files

        Comment

        • Wallysb01
          Senior Member
          • Feb 2011
          • 286

          #5
          Eek, Ok. Did the frequency drop much. You can tell by the table under that figure.

          Also, how big are your inserts? Can you even attempt overlapping the reads?

          And you may just want to trim off those first 10bp for your next assembly. That may help.

          Finally, what kind of coverage do you have?

          Comment

          • fahmida
            Member
            • Aug 2010
            • 54

            #6
            Nope, the frequency doesn't drop much. Reads are 150bp and insert size is 400bp for 2 lanes and 700bp for another two lanes. hence, not much chance of overlaps.
            Yes, I did trim off 10bp in both directions and it's almost the same and seems like I am running out of options.
            Attached Files

            Comment

            • Wallysb01
              Senior Member
              • Feb 2011
              • 286

              #7
              You might try COPE (http://sourceforge.net/projects/coperead/). It can overlap reads using kmers, so reads don't have to actually overlap and instead just be close enough for high frequency kmers to span the gap. It may work pretty well with 2x150bp reads, because you could increase kmer sizes up a little bigger, assuming your coverage is pretty high too. And you can use the 700bp insert library to add to the kmer pool, but not attempt overlaps.

              With my shorter 170bp library, I found flash to work better, but the library was actually that small with very few >190bp. So that kmer method didn't seem to help much. And while you library may look like its 400bp, I've generally found libraries to be shorter than what sequencing cores say.

              Comment

              • fahmida
                Member
                • Aug 2010
                • 54

                #8
                Thanks for your suggestions. It would be good to have longer reads through overlaps, however, think I need to get rid of those funny k-mers first, isn't it?. I can't find a way to deal with that. Once I've quality data I can move to the next step.

                Comment

                • Wallysb01
                  Senior Member
                  • Feb 2011
                  • 286

                  #9
                  Those repetitive kmers are really just dinucleoties, so in kmer lengths around 21, for error correction and overlapping, they may not provide a huge obstacle.

                  In fact, you could up the kmer length to 10bp in fastqc to see if these sequences continue to be a problem. It maybe that certain reads are just filled with them and they could be removed with a very strict dust filtering. Say, you remove reads with a dust score of 30? There is really no reason to attempt to keep sequences with so many very, very low complexity sequences. While you of course ideally you'd want to try to assembly low complexity sequences, however in this case, they may be artifacts and providing more problems than they are worth.

                  Prinseq can do dust filtering, if you want to give it a shot. And it will separate out the good and bad seqs for inspection.

                  After playing with prinseq, you might actually want to drop that score a little lower, 20-ish?
                  Last edited by Wallysb01; 08-01-2013, 10:27 PM.

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                    by SEQadmin2



                    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                    Despite this, “CRISPR helped turn genome editing from a specialized technique into
                    ...
                    07-31-2026, 11:01 AM
                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM
                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    07-09-2026, 11:10 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 08-03-2026, 10:13 AM
                  0 responses
                  15 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-31-2026, 02:55 AM
                  0 responses
                  32 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-24-2026, 12:17 PM
                  0 responses
                  23 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-23-2026, 11:41 AM
                  0 responses
                  21 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...