yes, I think..see the link from where I got those files
-
-
That's normal, the fasta file(s) (*.fa) is/are used to make the indices (*.bt2), so there's no reason for it to create a copy.Comment
-
I think the fasta file is in fasta format, as when I open it in texteditor, the first few lines looks like this
>1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAATCC
TACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTTCTCTGGTTGAAAATCATTGT
GTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTATTGTTGTGTGTAGATTTTTTAAAAATATCA
TTTGAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTC
ATTTGTTATATTGGATACAAGCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTA
GGGTTGGTTTATCTC,
when i open this file in the terminal it looks
cat Arabidopsis_thaliana_NCBI_TAIR10/Arabidopsis_thaliana/NCBI/TAIR10/Sequence/Bowtie2Index/genome.fa
XSym
0029
7ec8fcfa270da919afc1f0afd221e788
../WholeGenomeFasta/genome.fa
so fasta file seems to be goodComment
-
ok,,now I understand that why I don't see copy of fasta file, when I create indicesComment
-
Ah, after a bit of googling and a hunch, are you using Mac OSX and these files are being held on a fat32 formatted file system (likely an external hard drive, or maybe even a network share via samba)? That is what a symbolic link looks like in these situations (who knew?). If you get this result when you use cat, then I expect the link is also not transparent for gtf_to_fasta. In that case, you might have to copy the ../WholeGenomeFasta/genome.fa file to Arabidopsis_thaliana_NCBI_TAIR10/Arabidopsis_thaliana/NCBI/TAIR10/Sequence/Bowtie2Index/genome.faOriginally posted by hathiram2 View PostComment
-
libz warning?
dpryan, how does one ignore the libz warning? I got that warning while trying to use bam2fastx from top hat 2.0.9...Originally posted by dpryan View PostComment
-
NGS has revolutionized clinical microbiology by offering new ways to identify and surveil pathogens without prior knowledge of the target. One popular approach is 16S rRNA and ITS amplicon sequencing, which targets specific microbial markers. But studies are increasingly incorporating shotgun metagenomics, a technique that sequences all DNA from a sample without targeting specific microbial markers. This approach allows more detailed taxonomic classification, detection...10-30-2026, 06:46 AM -
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM
Comment