Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • shocker8786
    Member
    • Jan 2013
    • 28

    Trim Galore output issue

    I have both RRBS and RNAseq datasets that I'm trying to filter for quality and trim adaptors using Trim Galore. When I run it on the RRBS fq files using the --RRBS option, the resulting fq output looks fine:

    @HWI-ST330:336274FACXX:3:1101:13152:1997 1:N:0:CTTGTA
    NGGGTTGTTTTATGGAGAGCGGAGGGT
    +
    #4=DDDFDHHHHHJJIJIIGJJIIJJ?
    @HWI-ST330:336274FACXX:3:1101:14593:1999 1:N:0:CTTGTA
    NGGTAATTCGTTTTTTATAAGGCGAAT
    +
    #1=DFFFFHHHHHJJJJJJJHGIJJJJ
    @HWI-ST330:336274FACXX:3:1101:18911:1998 1:N:0:CTTGTA
    NGGGGTTTAGACGTAGTAGGTGTTTT
    +
    #1=DFDDFHHHHHGHJGHIJAFFHIJ

    But when I run it on the RNAseq samples without the --RRBS option, there are additional spaces in the fastq output:

    @DBRHHJN1:326:C233EACXX:1:1101:1305:1193 1:N:0:ATCACG
    CTTTNTGTGGCTCAGGATGGAGGTGGCCACATTGGCCAGCAACTCAGCCAGGCCGGGGCCTTCCTTCCCAGCAATTCGAGGCGCGGCCAGCGCCTGCCGC

    +
    ???D#2=ADDDDDIIIIEFIEEF+CEDE>DDEIIEDBED=DDCEBDD@CDDDCDDIAD>@?AAAAAAA?AA=??AAA?E?>5;>;>95;8<;;>>???>>

    @DBRHHJN1:326:C233EACXX:1:1101:1287:1222 1:N:0:ATCACG
    CTTGNAAATGGCGTCAAAGGTGGCCTTGGCGAAGTTGCCCAGGGTGGCAGTGCAGCCCCTGGCAGAGGTGTAGCAGTCATCAATTCCTGCCATCATCAGC

    +
    ?@@D#2=AFHH?FH<ECFHHHGGEEGEGH@D@)?DHI9?BCFGIHII=@?7A;7?>BB?ACCA=?(98,<C:C:5,53:@>>4:@::@@CB>@93>>:::

    @DBRHHJN1:326:C233EACXX:1:1101:1252:1244 1:N:0:ATCACG

    I've tried running it a few different ways, and discovered that I only get the output with added spaces when I don't use the --RRBS option. My question is how do I fix this issue? I don't want to use the --RRBS option with the RNAseq data, as it will remove an additional 2bp from the trimmed reads. Is there a way to prevent Trim Galore from adding these spaces? Or is there a way for me to remove the spaces from the output files? Thanks!
  • choishingwan
    Member
    • Feb 2012
    • 21

    #2
    The simplest way might be to use awk? (but will be slow)

    awk '{if(length($0)>=1)print $0}' input.fq
    something like that, I haven't tested the code though...

    Comment

    • fkrueger
      Senior Member
      • Sep 2009
      • 627

      #3
      This was a bug that had been introduced accidentally... If you get the latest version of Trim Galore it should be fine, sorry for the inconvenience caused. This is from the latest release notes:

      Code:
      10-09-13: Version 0.3.3 released
      
          Fixed a bug what was accidentally introduced which would add an additional empty line in single-end trimming mode

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      27 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      37 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      24 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      35 views
      0 reactions
      Last Post SEQadmin2  
      Working...