Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Ling
    Junior Member
    • Jan 2010
    • 8

    Question on SAMtools variations calling of a BFAST-aligned SAM file?

    Hi all,


    I had problems in using SAMtools to call the variations from a BFAST- aligned SAM file.

    The commands I used:

    $ samtools-0.1.7/samtools view -bS -q 20 bfast.aln.sam > bfast.aln.bam
    $ samtools-0.1.7/samtools sort bfast.aln.bam bfast-aln.sorted
    $ samtools-0.1.7/samtools index bfast-aln.sorted.bam
    $ samtools-0.1.7/samtools pileup -vcf TAIR9genomeSeq.txt bfast-aln.sorted.bam | tee bfast-raw.txt | samtools-0.1.7/samtools.pl varFilter -D100 > bfast-flt.txt

    It had run for days in pileup step, with no error information and no output.

    The SAMtools worked fine with the BWA-aligned sam file from the same data.

    Is anything wrong with my Bfast-sam file? which look like:
    @HD VN:0.1.2
    @SQ SN:Chr1 LN:30427671
    @SQ SN:Chr2 LN:19698289
    @SQ SN:Chr3 LN:23459830
    @SQ SN:Chr4 LN:18585056
    @SQ SN:Chr5 LN:26975502
    @SQ SN:chloroplast LN:154478
    @SQ SN:mitochondria LN:366924
    @PG ID:bfast VN:0.6.2a
    HWI-EAS412:2:1:0:1469#0/1 4 * 0 0 * * nttcctatcaaggttaaggagtcaactgagcatctcagcggcgggattgaatacccggatcgaatcagagttcacg DOXVYWYWWWWVWWYYWWTWVWWWWWWWWYWYWWYWUSVYVWWWVNUUSUWWWQUGVRRRUPTUPWUUWTVSLRPU PG:Z:bfast AS:i:-2147483648 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:* XA:i:3
    HWI-EAS412:2:1:1:1078#0/1 4 * 0 0 * * ncgccccggccgatatcctcaaccagctggccacgtagatcggaagagctcgtatgccgtcttcttctttaaaaaa DNVUWXXVWWSUVWWXUUWWVWWUWWVNSUURWQVWUSXWUUUUWWSSNUNSVWWFNJNVVVVQTKOVSGOVSUVS PG:Z:bfast AS:i:-2147483648 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:* XA:i:3
    HWI-EAS412:2:1:1:660#0/1 16 Chr3 13591936 10 76M tgattaagtataagaacttaaaccgcaacatgatcttaaaggcgtaagaattgtatccttgttaaaagacacaaan BBXXXZ[[Z[Y[WWW[[[[[YVRVY[[[[YZY[ZYULV[[ZYY[[[ZZZ[[[[[[XVSX[[[[[[[[ZYYYVY[OD PG:Z:bfast AS:i:3000 NM:i:4 NH:i:1 IH:i:1 HI:i:1 MD:Z:5G23CC44G XA:i:3
    HWI-EAS412:2:1:1:1493#0/1 0 Chr1 14102811 40 76M natcttcttgaagtgtgaaatacttcatcaaacggtggagaatacttctcccttggtcactcgatcaaacggtgag DOZZZZZZYYYYYXSXYYZZZZXZZZZZXZZZZXZZYYYXZZZZZZZZZYVXZZYWYWZZZXZZXXZZZZUURZXV PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:T75 XA:i:3
    HWI-EAS412:2:1:1:1133#0/1 16 Chr4 3403799 50 76M * gtttgttctctcacttggcgagcaatacggtcgatgttatcgttgaatagaaggttctgaattccttgtgaccgtn BTWYYWYVYWWWTVWVYYWWYSSVYYVSTVWYWZZZXZZYWYZXZZZZZZZYYYZWSWYYZZWUUWZZYYVPLTOD PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:75G XA:i:3
    HWI-EAS412:2:1:1:144#0/1 16 Chr2 15897161 255 76M agtaccgaatcgttggatgatgatggtagtgatgatcgtggtggtaatgagatccgctagaggaggaaccatttgn YYXWUWVWYWVWYVVUVYUYXWYXYXYYYYYYYYYXYYYYXYYYXYYYYYYYYYYYXYYXYYYYYYYYYYURUYOD PG:Z:bfast AS:i:3400 NM:i:2 NH:i:1 IH:i:1 HI:i:1 MD:Z:71A3A XA:i:3
    HWI-EAS412:2:1:1:502#0/1 4 * 0 0 * * ntcttagatctcacaaaaaagaccaaaagtaattcaactgatgaatttagataaagtaatttgtcttctaaaccca DP[[[ZYZ[[[[[[[[[[[ZYZ[[YYYYXY[[[[[Z[[[[[[[[Z[[[YTYZ[[[[Y[Z[[XXXY[[W[YYXURVW PG:Z:bfast AS:i:-2147483648 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:* XA:i:3
    HWI-EAS412:2:1:1:1922#0/1 0 mitochondria 210296 255 76M naagagcaaagcgtggctttttgccccggggcactagggcctgatcatctttatggctataaatctggcttccaag DOWWXWXYWYYYYWYYWYYYYWTUWXWXWWWWWWWWWXWWVWWYWWWWWWYWWWBBBBBBBBBBBBBBBBBBBBBB PG:Z:bfast AS:i:3000 NM:i:4 NH:i:1 IH:i:1 HI:i:1 MD:Z:C66C4AC2 XA:i:3
    HWI-EAS412:2:1:1:1659#0/1 16 Chr2 18335755 255 76M ggcaggaacaaacagaaacagacagagtcgaaaacaaattcgtcgaatgataatagtagtaaacaagacacaggtn BTOTQOSYVYYXYXXXYYYXXXZZZZZZZXZZZZZZZZZZZZYXYZZZZZZZZZZZZZZXZZYYYZZZXZZZZZND PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:75A XA:i:3
    HWI-EAS412:2:1:1:477#0/1 0 Chr3 18560494 255 76M natgtggttcagttttgtatggtttttttgtctgtgactatttgttaatggtacgtttttgaatgccccaaatcaa DM[[WSSLPWY[W[Y[[WZ[W[ZYVYYYY[[VZYSVYXZX[XXTYYVYXPXVSRT[YYYXXRUXXSYLQQUXXSUX PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:A75 XA:i:3
    HWI-EAS412:2:1:1:1430#0/1 0 Chr4 4184778 28 76M * ntcgagtagtttcgtttcctcagtttacaagtgattgacatgctcaataaattaccctacacaacaagttcattaa DOVUXXXVXXXTTRVXYVTVYXXXZZZVTSYXXXYYYTTTXVVVXTXXYVXXYYVRTVVUWWSSOQVTXSOQYYTT PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:A75 XA:i:3


    My reads are 76 bp and I used bfast-0.6.2a

    Thank you very much for your attention and help!


    Ling
  • nilshomer
    Nils Homer
    • Nov 2008
    • 1283

    #2
    Originally posted by Ling View Post
    Hi all,


    I had problems in using SAMtools to call the variations from a BFAST- aligned SAM file.

    The commands I used:

    $ samtools-0.1.7/samtools view -bS -q 20 bfast.aln.sam > bfast.aln.bam
    $ samtools-0.1.7/samtools sort bfast.aln.bam bfast-aln.sorted
    $ samtools-0.1.7/samtools index bfast-aln.sorted.bam
    $ samtools-0.1.7/samtools pileup -vcf TAIR9genomeSeq.txt bfast-aln.sorted.bam | tee bfast-raw.txt | samtools-0.1.7/samtools.pl varFilter -D100 > bfast-flt.txt

    It had run for days in pileup step, with no error information and no output.

    The SAMtools worked fine with the BWA-aligned sam file from the same data.

    Is anything wrong with my Bfast-sam file? which look like:
    @HD VN:0.1.2
    @SQ SN:Chr1 LN:30427671
    @SQ SN:Chr2 LN:19698289
    @SQ SN:Chr3 LN:23459830
    @SQ SN:Chr4 LN:18585056
    @SQ SN:Chr5 LN:26975502
    @SQ SN:chloroplast LN:154478
    @SQ SN:mitochondria LN:366924
    @PG ID:bfast VN:0.6.2a
    HWI-EAS412:2:1:0:1469#0/1 4 * 0 0 * * nttcctatcaaggttaaggagtcaactgagcatctcagcggcgggattgaatacccggatcgaatcagagttcacg DOXVYWYWWWWVWWYYWWTWVWWWWWWWWYWYWWYWUSVYVWWWVNUUSUWWWQUGVRRRUPTUPWUUWTVSLRPU PG:Z:bfast AS:i:-2147483648 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:* XA:i:3
    HWI-EAS412:2:1:1:1078#0/1 4 * 0 0 * * ncgccccggccgatatcctcaaccagctggccacgtagatcggaagagctcgtatgccgtcttcttctttaaaaaa DNVUWXXVWWSUVWWXUUWWVWWUWWVNSUURWQVWUSXWUUUUWWSSNUNSVWWFNJNVVVVQTKOVSGOVSUVS PG:Z:bfast AS:i:-2147483648 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:* XA:i:3
    HWI-EAS412:2:1:1:660#0/1 16 Chr3 13591936 10 76M tgattaagtataagaacttaaaccgcaacatgatcttaaaggcgtaagaattgtatccttgttaaaagacacaaan BBXXXZ[[Z[Y[WWW[[[[[YVRVY[[[[YZY[ZYULV[[ZYY[[[ZZZ[[[[[[XVSX[[[[[[[[ZYYYVY[OD PG:Z:bfast AS:i:3000 NM:i:4 NH:i:1 IH:i:1 HI:i:1 MD:Z:5G23CC44G XA:i:3
    HWI-EAS412:2:1:1:1493#0/1 0 Chr1 14102811 40 76M natcttcttgaagtgtgaaatacttcatcaaacggtggagaatacttctcccttggtcactcgatcaaacggtgag DOZZZZZZYYYYYXSXYYZZZZXZZZZZXZZZZXZZYYYXZZZZZZZZZYVXZZYWYWZZZXZZXXZZZZUURZXV PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:T75 XA:i:3
    HWI-EAS412:2:1:1:1133#0/1 16 Chr4 3403799 50 76M * gtttgttctctcacttggcgagcaatacggtcgatgttatcgttgaatagaaggttctgaattccttgtgaccgtn BTWYYWYVYWWWTVWVYYWWYSSVYYVSTVWYWZZZXZZYWYZXZZZZZZZYYYZWSWYYZZWUUWZZYYVPLTOD PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:75G XA:i:3
    HWI-EAS412:2:1:1:144#0/1 16 Chr2 15897161 255 76M agtaccgaatcgttggatgatgatggtagtgatgatcgtggtggtaatgagatccgctagaggaggaaccatttgn YYXWUWVWYWVWYVVUVYUYXWYXYXYYYYYYYYYXYYYYXYYYXYYYYYYYYYYYXYYXYYYYYYYYYYURUYOD PG:Z:bfast AS:i:3400 NM:i:2 NH:i:1 IH:i:1 HI:i:1 MD:Z:71A3A XA:i:3
    HWI-EAS412:2:1:1:502#0/1 4 * 0 0 * * ntcttagatctcacaaaaaagaccaaaagtaattcaactgatgaatttagataaagtaatttgtcttctaaaccca DP[[[ZYZ[[[[[[[[[[[ZYZ[[YYYYXY[[[[[Z[[[[[[[[Z[[[YTYZ[[[[Y[Z[[XXXY[[W[YYXURVW PG:Z:bfast AS:i:-2147483648 NM:i:0 NH:i:1 IH:i:1 HI:i:1 MD:Z:* XA:i:3
    HWI-EAS412:2:1:1:1922#0/1 0 mitochondria 210296 255 76M naagagcaaagcgtggctttttgccccggggcactagggcctgatcatctttatggctataaatctggcttccaag DOWWXWXYWYYYYWYYWYYYYWTUWXWXWWWWWWWWWXWWVWWYWWWWWWYWWWBBBBBBBBBBBBBBBBBBBBBB PG:Z:bfast AS:i:3000 NM:i:4 NH:i:1 IH:i:1 HI:i:1 MD:Z:C66C4AC2 XA:i:3
    HWI-EAS412:2:1:1:1659#0/1 16 Chr2 18335755 255 76M ggcaggaacaaacagaaacagacagagtcgaaaacaaattcgtcgaatgataatagtagtaaacaagacacaggtn BTOTQOSYVYYXYXXXYYYXXXZZZZZZZXZZZZZZZZZZZZYXYZZZZZZZZZZZZZZXZZYYYZZZXZZZZZND PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:75A XA:i:3
    HWI-EAS412:2:1:1:477#0/1 0 Chr3 18560494 255 76M natgtggttcagttttgtatggtttttttgtctgtgactatttgttaatggtacgtttttgaatgccccaaatcaa DM[[WSSLPWY[W[Y[[WZ[W[ZYVYYYY[[VZYSVYXZX[XXTYYVYXPXVSRT[YYYXXRUXXSYLQQUXXSUX PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:A75 XA:i:3
    HWI-EAS412:2:1:1:1430#0/1 0 Chr4 4184778 28 76M * ntcgagtagtttcgtttcctcagtttacaagtgattgacatgctcaataaattaccctacacaacaagttcattaa DOVUXXXVXXXTTRVXYVTVYXXXZZZVTSYXXXYYYTTTXVVVXTXXYVXXYYVRTVVUWWSSOQVTXSOQYYTT PG:Z:bfast AS:i:3600 NM:i:1 NH:i:1 IH:i:1 HI:i:1 MD:Z:A75 XA:i:3


    My reads are 76 bp and I used bfast-0.6.2a

    Thank you very much for your attention and help!


    Ling
    What does the "samtools-0.1.7/samtools pileup -vcf TAIR9genomeSeq.txt" command give you? The other steps after pileup I have not seen before.

    Nils

    Comment

    • Ling
      Junior Member
      • Jan 2010
      • 8

      #3
      Hi Nils,

      Thank you very much for your reply.

      I always pipe the pileup results into filter step and thus never got the output from pileup.

      I re-ran the pileup step after read your message. Here is the results:
      Chr1 31 T T 33 0 47 2 .+3AAA. `b
      Chr1 31 * */+AAA 32 32 47 2 * +AAA 0
      Chr1 144 T W 0 0 60 2 ,a aB
      Chr1 145 A A 33 0 60 2 ,,-1t aB
      Chr1 145 * -T/-T 0 0 60 2 -T * 0
      Chr1 1075 T C 30 30 60 1 c+3gag B
      Chr1 1075 * +GAG/+GAG 41 35 60 1 +GAG 0
      Chr1 1096 C C 30 0 60 1 ,+8cccgccct ]
      Chr1 1096 * +CCCGCCCT/+CCCGCCCT 41 35 60 1 +CCCGCCCT * 1 0 0 0 0
      Chr1 1099 A A 30 0 60 1 ,+1c M
      Chr1 1099 * +C/+C 41 35 60 1 +C * 0
      Chr1 1100 A A 30 0 60 1 ,+9gccgcccgt a
      Chr1 1100 * +GCCGCCCGT/+GCCGCCCGT 41 35 60 1 +GCCGCCCGT * 1 0 0 0 0
      Chr1 1102 T T 30 0 60 1 ,+5ccccc [
      Chr1 1102 * +CCCCC/+CCCCC 41 35 60 1 +CCCCC 0
      Chr1 1104 A C 30 30 60 1 c-1g X
      Chr1 1104 * -G/-G 41 35 60 1 -G * 0
      Chr1 1105 G A 0 0 0 1 * a
      Chr1 1107 A A 30 0 60 1 ,+8ctttctct _
      Chr1 1107 * +CTTTCTCT/+CTTTCTCT 41 35 60 1 +CTTTCTCT * 1 0 0 0 0
      Chr1 1109 T T 30 0 60 1 ,+2gc a
      Chr1 1109 * +GC/+GC 41 35 60 1 +GC * 0
      Chr1 1579 T W 2 2 60 2 ,n [D
      Chr1 1596 T Y 21 21 60 2 c, Wa
      Chr1 2467 G R 19 19 60 5 ,.a., `_^a_
      Chr1 3272 A W 28 28 60 3 t,, abb
      Chr1 4018 A R 19 19 60 5 ,.g.. a`^``
      Chr1 4030 G S 1 1 60 7 ,.,C... `]`Raa_
      Chr1 4134 A W 7 7 60 10 ..,,,,,,T, ^[_a^`aaa]
      Chr1 4264 A W 29 29 60 2 ,t a_
      Chr1 4382 G R 2 2 60 2 N. Da
      Chr1 4423 A R 22 29 60 2 ,G X_
      Chr1 4635 T W 2 2 60 11 ,..A,,..... baa_aababab
      Chr1 4654 A R 8 8 60 9 ..,,.G... __bbb_a``
      Chr1 4870 C M 14 14 60 7 .,.,,a. [bBa`_a
      Chr1 4881 T T 42 0 60 5 .+1G,,., BaYa_
      Chr1 4881 * */+G 23 23 60 5 * +G 0
      Chr1 4885 T T 42 0 60 5 .+1G,,., Ba`U`
      Chr1 4885 * */+G 23 23 60 5 * +G 0


      It looks good for me, and now I am runing the filtering step. I will let you know the results

      Best,

      Ling

      Comment

      • Ling
        Junior Member
        • Jan 2010
        • 8

        #4
        Hi Nils,

        It's working now!

        But I do still not understand why it wasn't working by using:

        $ samtools-0.1.7/samtools pileup -vcf TAIR9genomeSeq.txt bfast-aln.sorted.bam | tee bfast-raw.txt | samtools-0.1.7/samtools.pl varFilter -D100 > bfast-flt.txt

        but working by:
        $ samtools-0.1.7/samtools pileup -vcf TAIR9genomeSeq.txt bfast-aln.sorted.bam > bfast.pileup;

        $ samtools-0.1.7/samtools.pl varFilter -D100 bfast.pileup > bwa-flt.txt

        Thank you for you help!

        Ling

        Comment

        • nilshomer
          Nils Homer
          • Nov 2008
          • 1283

          #5
          Originally posted by Ling View Post
          Hi Nils,

          It's working now!

          But I do still not understand why it wasn't working by using:

          $ samtools-0.1.7/samtools pileup -vcf TAIR9genomeSeq.txt bfast-aln.sorted.bam | tee bfast-raw.txt | samtools-0.1.7/samtools.pl varFilter -D100 > bfast-flt.txt

          but working by:
          $ samtools-0.1.7/samtools pileup -vcf TAIR9genomeSeq.txt bfast-aln.sorted.bam > bfast.pileup;

          $ samtools-0.1.7/samtools.pl varFilter -D100 bfast.pileup > bwa-flt.txt

          Thank you for you help!

          Ling
          Very odd indeed. I am glad it is working for you.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 12:17 PM
          0 responses
          11 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-23-2026, 11:41 AM
          0 responses
          11 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-20-2026, 11:10 AM
          0 responses
          23 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-13-2026, 10:26 AM
          0 responses
          37 views
          0 reactions
          Last Post SEQadmin2  
          Working...