Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • martinobarenco
    Junior Member
    • Jan 2010
    • 8

    bowtie index location question

    Dear all,

    when I type the command:

    ~/where/my/data/is $ bowtie -a -v 2 hg19 -c GTTCGATGAAATCTTCTTTTTCTGTTTTCACTTGGG

    the following message is returned:

    Could not locate a Bowtie index corresponding to basename "hg19"
    Command: bowtie -a -v 2 -c hg19 GTTCGATGAAATCTTCTTTTTCTGTTTTCACTTGGG

    whereas it works fine when run from the directory where bowtie actually is. I am a bit loth copying the data where the program is, so is there a way to specify the bowtie index(es) path?

    Many thanks,

    Martino
  • manoj123
    Junior Member
    • Dec 2009
    • 2

    #2
    Hi Martino,

    You can try absolute path of the index like below

    ~/where/my/data/is $ bowtie -a -v 2 /location/of/index/hg19 -c GTTCGATGAAATCTTCTTTTTCTGTTTTCACTTGGG

    your index (.ebwt files) must be at /location/of/index/hg19.*.ebwt
    Last edited by manoj123; 02-09-2010, 04:39 AM.

    Comment

    • martinobarenco
      Junior Member
      • Jan 2010
      • 8

      #3
      Thanks for the prompt answer, it works. It works also with the relative path (which I had tried initially), but the full path has to be specified. ie the path to the location of the executable is not enough.

      Comment

      • martinobarenco
        Junior Member
        • Jan 2010
        • 8

        #4
        alternatively one can specify the path in the BOWTIE_INDEXES environment variable. I did that by adding the line below in the .bashrc file:

        export BOWTIE_INDEXES=absolute/path/to/bowtie/indexes

        then the path does not need to be repeated in the bowtie command.

        (actually, this is well documented in the bowtie manual but the n00b that I am could not figure that one out)

        Comment

        • Fumumumu
          Junior Member
          • Jan 2011
          • 3

          #5
          I am struggling almost same problem.

          I wanted to divide bowtie job by chrmosome in order to make grid jobs.
          In the beginnig, I made each chromesome in /var/indexes/mm9masked_chrXX/index/, respectively. Each base name was mm9masked_chrXX

          Bowtie could find chr1 base name, but not other base names.
          What's wrong?
          Each bowtie job was like this;

          bowtie --sam -C --best -f -Q /path/to/data.qual /var/indexes/mm9maked_chr2/indexes/mm9masked_chr2 /path/to/data.csfasta /path/to/data_chr2.sam

          Error message was as follws.
          Could not locate a Bowtie index corresponding to basename "/var/indexes/mm9maked_chr2/indexes/mm9masked_chr2

          $ls -l /var/indexes/mm9maked_chr2/indexes
          -rw-r--r-- 1 fumumumu staff 37334426 1 11 18:15 mm9maked_chr2.1.ebwt
          -rw-r--r-- 1 fumumumu staff 52439512 1 11 18:15 mm9maked_chr2.2.ebwt
          -rw-r--r-- 1 fumumumu staff 2439962 1 11 18:14 mm9maked_chr2.3.ebwt
          -rw-r--r-- 1 fumumumu staff 26287529 1 11 18:14 mm9maked_chr2.4.ebwt
          -rw-r--r-- 1 fumumumu staff 37334426 1 11 18:17 mm9maked_chr2.rev.1.ebwt
          -rw-r--r-- 1 fumumumu staff 52439512 1 11 18:17 mm9maked_chr2.rev.2.ebwt
          Last edited by Fumumumu; 01-13-2011, 12:14 AM.

          Comment

          • fkrueger
            Senior Member
            • Sep 2009
            • 627

            #6
            Originally posted by Fumumumu View Post
            I am struggling almost same problem.

            I wanted to divide bowtie job by chrmosome in order to make grid jobs.
            In the beginnig, I made each chromesome in /var/indexes/mm9masked_chrXX/index/, respectively. Each base name was mm9masked_chrXX

            Bowtie could find chr1 base name, but not other base names.
            What's wrong?
            Each bowtie job was like this;

            bowtie --sam -C --best -f -Q /path/to/data.qual /var/indexes/mm9maked_chr2/indexes/mm9masked_chr2 /path/to/data.csfasta /path/to/data_chr2.sam

            Error message was as follws.
            Could not locate a Bowtie index corresponding to basename "/var/indexes/mm9maked_chr2/indexes/mm9masked_chr2

            $ls -l /var/indexes/mm9maked_chr2/indexes
            -rw-r--r-- 1 fumumumu staff 37334426 1 11 18:15 mm9maked_chr2.1.ebwt
            -rw-r--r-- 1 fumumumu staff 52439512 1 11 18:15 mm9maked_chr2.2.ebwt
            -rw-r--r-- 1 fumumumu staff 2439962 1 11 18:14 mm9maked_chr2.3.ebwt
            -rw-r--r-- 1 fumumumu staff 26287529 1 11 18:14 mm9maked_chr2.4.ebwt
            -rw-r--r-- 1 fumumumu staff 37334426 1 11 18:17 mm9maked_chr2.rev.1.ebwt
            -rw-r--r-- 1 fumumumu staff 52439512 1 11 18:17 mm9maked_chr2.rev.2.ebwt
            Apparently it is just a typo in the actual index files:

            They are called mm9maked and not mm9masked!

            Comment

            • Fumumumu
              Junior Member
              • Jan 2011
              • 3

              #7
              yaaaaaaaaaaaaah!





              Thank you so much.....

              Comment

              • andrehorta
                Member
                • Jan 2011
                • 14

                #8
                Dears, i need your help!

                When i typed the command: bowtie -p 4 rs4244385A

                The folow message is returned:

                could not locate bowtie index corresponding to basename rs4244385A

                I was try to put the complete path, but not solved the problem.

                This rs4244385A was generated for me, through the command bowtie-build rs4244385A.fa rs4244385A.ebwt;

                Thanks

                Comment

                • kmcarr
                  Senior Member
                  • May 2008
                  • 1181

                  #9
                  Originally posted by Fumumumu View Post
                  I am struggling almost same problem.

                  I wanted to divide bowtie job by chrmosome in order to make grid jobs.
                  Dividing the jobs by chromosome is not a good approach to splitting up the bowtie workload. If you want to divide the alignment across multiple nodes you should split up the reads into smaller groups and align each group of reads against the entire genome of your organism.

                  Imagine that you have a read which matches chr3 with one mismatch and chr9 with zero mismatches. Since you are running bowtie with the --best option you would only want the perfect alignment to chr9 returned. By your method bowtie is assessing alignments to each chromosome without consideration for possible better alignments to other chromosomes. You would then need to perform some sort of secondary processing on your multiple bowtie outputs to pick the best alignment(s) among all of the per chromosome alignments.

                  Split your reads into however many jobs you want run, align each group to the total genome and then merge the resulting BAM files using samtools.

                  Comment

                  • stoker
                    Member
                    • Oct 2010
                    • 17

                    #10
                    I have reversed problem - my bowtie runs well with reference name (ex. hg19) but does not work with the full path of indexes, which I need for my local Galaxy.

                    This does not work:
                    bowtie -q -p 4 -S --sam-nohead /.../bowtie-0.12.7/indexes/test_ref /.../test_file.fastq

                    This works:
                    bowtie -q -p 4 -S --sam-nohead test_ref /.../test_file.fastq

                    Any suggestions how to make my full path reference working?
                    Tomasz Stokowy
                    www.sequencing.io.gliwice.pl

                    Comment

                    • giampe
                      Member
                      • Aug 2009
                      • 23

                      #11
                      hi all,
                      I'm writing my problem about running of bowtie in this thread, even if I'm using bowtie to run another program named Paparazzi (Vodovar et al 2011).
                      the error coming out is:

                      [user1@netlab01:~/data_from_testuser1]$ paparazzi /home/user1/data_from_testuser1/paparazzi_new_version/paparazzi_conf_file.txt
                      P1B_Y_trim_clip.fastq GPGV
                      Creating target directories
                      Filtering host-derived reads
                      Could not locate a Bowtie index corresponding to basename "path_to_reference_genome_bowtie_library_including_library_basename"
                      Command: bowtie -v 0 --threads 4 --solexa-quals --quiet --un ../filtered/P1B_Y_trim_clip.fastq_unmatched.fq path_to_reference_genome_bowtie_library_including_library_basename /home/user1/data_from_testuser1/LIBRERIE_OTTOBRE/P1B/36trimmed/P1B_Y_trim_clip.fastq
                      Died at /home/user1/bin/paparazzi line 80, <$fh> line 1.


                      I'm frustated everything seems ok!

                      Comment

                      • carolW
                        Senior Member
                        • Apr 2013
                        • 103

                        #12
                        Hi
                        Although I use the right path to the index file, bowtie can't find it

                        /home/carolw/Desktop/bowtie-1.0.1/bowtie -x /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index -r /home/carolw/rawSeq -S /home/carolw/rawSeq.sam

                        Could not locate a Bowtie index corresponding to basename " /home/carolw/rawSeq"
                        Command: /home/carolw/Desktop/bowtie-1.0.1/bowtie -x /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index -r -S /home/carolw/rawSeq /home/carolw/rawSeq.sam

                        ls /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index*
                        /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.1.ebwt
                        /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.2.ebwt
                        /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.3.ebwt
                        /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.4.ebwt
                        /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.rev.1.ebwt
                        /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index.rev.2.ebwt

                        Comment

                        • GenoMax
                          Senior Member
                          • Feb 2008
                          • 7142

                          #13
                          Order of options provided for bowtie are important. I am not sure if -x is needed and -r needs to be followed by your read files. -S needs to go with your sam file.

                          Comment

                          • dpryan
                            Devon Ryan
                            • Jul 2011
                            • 3478

                            #14
                            The -x option is for bowtie2. You want
                            Code:
                            /home/carolw/Desktop/bowtie-1.0.1/bowtie -r -S /home/carolw/Desktop/bowtie-1.0.1/indexes/g1_bt1_index /home/carolw/rawSeq /home/carolw/rawSeq /home/carolw/rawSeq.sam

                            Comment

                            • carolW
                              Senior Member
                              • Apr 2013
                              • 103

                              #15
                              yes, I removed -x and it works

                              many thx

                              Comment

                              Latest Articles

                              Collapse

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 06-09-2026, 11:58 AM
                              0 responses
                              15 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-05-2026, 10:09 AM
                              0 responses
                              26 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-04-2026, 08:59 AM
                              0 responses
                              37 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-02-2026, 12:03 PM
                              0 responses
                              61 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...