Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #46
    WhatSoEver,

    If you have a cigar string like ths:

    20=1I20=1D20=25D20=20I20=

    ...I would calculate:
    (20+20+20+20+20) matches / (20+1+20+root(1)+20+25+20+root(25)+20)
    =
    (100)/(20+1+20+1+20+25+20+5+20)
    =
    (100)/(132)=75.75%

    I know that's asymmetric - if there's a deletion, aligning the reference to the read would give a different identity than the read to the reference - but there are a couple reasons for that. First, you can get deletions of unbounded length in cigar strings, but insertions can never be longer than the read length, so it is (according to my logic) important to correct for deletions but not really anything else. Second, insertions occur INSTEAD of matches, while deletions occur IN ADDITION to matches. So if a 100bp read has 1 bp match and 99bp insertion, does it make sense to call that 1/(1+root(99)) = about 10% identity? Not really. But with a 100bp deletion in the middle, you'd have 100/110 = about 90% identity, which is maybe a bit high, but it seems reasonable for an alignment with two nearby 50bp consecutive matches, which can't arise by chance. Third, it seems to me that long deletions are more common than long insertions, but that could be discovery bias. Lastly, decreasing the identity penalty of insertions would cause a particular problem. Let's say you have a chimeric 200bp read, 100bp from somewhere in chromosome 1 and 100bp from chromosome 2. You could map it in two places, with cigars string of 100=100I and 100I100=, or 100=100X and 100X100=. My current formula would give that 50% identity for either location, whether it used the X or I symbol for the chimeric bases. But if you take the root of the insertions, then you get 100/(100+10) = 91% identity to two different sequences that have nothing in common, which does not make sense.

    It could be that calculating identity this way is not a good idea; I may put in a flag to remove the sqrt from deletions, but it seems to me that it gives a more useful answer in terms of short-read alignment when doing recruitment studies, which is what I actually put the idtag in for.

    Originally posted by WhatsOEver View Post
    intronlength=10 is the standard value, isn't it? I didn't set it, but can neither find any cigar strings with deletions greater than 10D nor one with N's smaller than 11N.
    By default, it is disabled. However, if you set other flags like "xstag" that are used by Tophat, and you don't explicitly set "intronlen", it will be automatically enabled and set to 10.

    And one last question out of interest as I worked in fungal genomics before I changed to humans: Why would you suggest a maxindel of 16000 for fungi? From what I analyzed (Comparative genomics of 200+ asco- and basidiomycetes) they are rarely longer than 100bp and I never saw one longer than 3kb (though I'm atm not sure if this was even mitochondrial).
    Well, I said "for plants and fungi". I work with fungi and the introns I've seen tend to be 300bp or less, and some of the plants I've seen also seem to have short introns of typically 250bp or so. But I don't know if there might be some out there that are different! The main reason is that very high settings of 'maxindel' (over 100kb) decrease speed and accuracy, but low settings like 16000 don't really have a noticeable effect on either yet it COULD let you discover something new. So I generally run with 16k as the default for BBMap even on DNA. The PacBio version has a lower default because PacBio reads are very long and have a high error rate (which exacerbates the effect on speed and accuracy), and we don't do RNA-seq for PacBio right now.

    Comment

    • Mchicken
      Member
      • Jan 2014
      • 39

      #47
      Hey Brian,

      i just briefly checked BBMap and have some questions.

      1) I am working, among others, with RNA-Seq data of a cyanobacterium. Is it possible that BBMap performs a spliced alignments for my RNA-Seq data? In a small run i did not observed spliced alignments but nevertheless i was wondering about it. If so, can i prevent this case by setting 'intronlen' to 0?

      2) Is there a way to apply soft- or hard-clipping?
      For example bwa performs for a read soft-clipping leading to 94M6S where BBMap leads to 100M although the last 6 bases are partially mismatches and therefor i want them to be clipped.

      3) Is there a way to determine the maximal number of mismatches?

      4) For CRAC and PAR-Clip sequencing data i want only 1 respectively 2 mismatches/indels. So when i want at most 2 indels i have to set maxindel= 2 and strictmaxindel = true. Am i right?

      5) Does BBMap reports only the best alignment (or best alignments if alignments with equal quality are present) or is there a way to report also alignments that are not as good as the best alignment? Would this be the maxsites option?

      Thanks for your nice support!

      Mchicken

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #48
        Mchicken,

        1) 'intronlen' does not actually affect alignment, just the way splices are reported - deletions shorter than 'intronlen' will have a 'D' symbol in the cigar string, while longer ones will have an 'N' symbol. To prevent gapped alignments, you should set 'maxindel=0', which will prevent them from being looked for, though some may still be found (or 'strictmaxindel=0' to absolutely ban all alignments with indels). But prokaryotes do have some self-splicing; these are typically very short, like 20bp or so, I think. So you may want to set 'maxindel=100' or something like that, which will prevent long ones.

        2) Soft-clipping is applied by default if a read goes off the end of a scaffold. You can also force it on alignments like the one you describe with the flag 'local=t'. Also, note that if you use the flag 'sam=1.4' then cigar strings will be generated with '= for match and 'X' for mismatch, instead of 'M' for both.

        3) You can use a flag like 'minid=98' to prevent alignments with lower than approximately 98% identity, which would be 2 mismatches for a 100bp read, but substitutions, deletions, and insertions are all scored differently, and whether they are contiguous or scattered also affects the score, so this is not exact. BBMap does not have any way to ensure that the best alignment with at most X mismatches is returned, like Bowtie 1 can do, because the scoring is fundamentally different.

        4) "maxindel" actually controls the length of individual indels, not the number of them, which is not controlled. There's also a "maxindel2" flag that controls the sum of the length of all indels, which by default is set to double maxindel. So if you did this:
        maxindel=10 maxindel2=15 strictmaxindel
        ...then individual indels could be up to 10bp; the sum of the length of indels could be up to 15bp; and any alignment with a single indel longer than 10bp would be banned. But there is no way to limit the total number of indel events.

        5) By default the best alignment is reported, and if there are multiple equally-scoring alignments, the first one (in genomic coordinates) is reported, but it is marked as ambiguous (XT:A:R tag). This corresponds to the setting 'ambig=best'. You can alternatively set 'ambig=random' or 'ambig=all' (which is what you are looking for). 'maxsites' will limit the total number of alignments displayed in 'ambig=all' mode, but won't have any effect in default mode.

        Thanks for using BBMap!

        -Brian

        Comment

        • simono101
          Junior Member
          • Feb 2014
          • 3

          #49
          Escaping spaces using the shell script

          Hi Brian,
          I can't seem to work out how to pass a filepath with spaces in it to BBMap using the shell script. Nothing that I normally would use seems to work...

          e.g.

          Code:
           ~/bbmap/bbmap.sh ref="../Reference\ genome/myref.fasta" build=2 in1=./Reads1.fastq.gz in2=./Reads2.fastq.gz out=./mapped.sam
          Yields the error

          Code:
          Exception in thread "main" java.lang.RuntimeException: Unknown parameter: genome/myref.fasta
          Is there a way to pass a string with escaped spaces to bbmap using the shell script or do I need to call bbmap directly?

          Thanks!

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142

            #50
            Have you pre-built the index for "myref.fasta"?
            Code:
            $ bbmap.sh ref=/path_to_your_genome.fa
            This step has to be done independently of the mapping step, AFAIK.
            Last edited by GenoMax; 05-28-2014, 03:34 AM. Reason: Deleted a part not relevant to original question

            Comment

            • GenoMax
              Senior Member
              • Feb 2008
              • 7142

              #51
              On second reading of your post, it appears that you have a space in your directory name and you are asking about escaping that? Let me test.

              Edit: Standard ways of escpaing spaces in shell script are not working but directly running the java command (escaping the space) is working.

              Brian should be able to provide the final answer.
              Last edited by GenoMax; 05-28-2014, 04:02 AM.

              Comment

              • simono101
                Junior Member
                • Feb 2014
                • 3

                #52
                @GenoMax,
                Thanks, yes your second post is exactly what I was referring to. I can't seem to find a way to escape the spaces in a directory path (but I too successfully called it directly rather than through the shell script).

                Comment

                • Brian Bushnell
                  Super Moderator
                  • Jan 2014
                  • 2709

                  #53
                  simono,

                  In Windows, you can handle that with quotes, e.g. ref="/a/path with spaces/x.fa"

                  In Linux... I don't know how to do it easily. Perhaps the easiest way would be to make a symlink that doesn't have any spaces. Alternatively, as in this article, you could export the path as an environment variable.

                  -Brian

                  Comment

                  • Thias
                    Member
                    • Mar 2013
                    • 45

                    #54
                    Hello Brian,

                    I need someone to give me a broad hint. I have already successfully indexed some eukaryotic genomes with BBMAP. But one PhD student in our lab has sequenced a custom shRNA library and I just wanted to use my usual aligner and just lower k-mer size. But it claims that it cannot read the FASTA with the reference sequences, although it is there. It there a lower limit of scaffold sizes (or a special parameter which I didn't set) which may cause BBMAP to abort with that error or is really the FASTA file somehow corrupted?

                    Code:
                    java -da -Xmx32g -cp /home/z/zepper/software/bbmap/current/ align2.BBMap build=1 overwrite=true match=long fastareadlen=500 ref=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa path=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/bbmap_index build=1 threads=4 -Xmx32g midpad=2000 k=5 minscaf=5
                    Executing align2.BBMap [build=1, overwrite=true, match=long, fastareadlen=500, ref=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa, path=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/bbmap_index, build=1, threads=4, -Xmx32g, midpad=2000, k=5, minscaf=5]
                    
                    BBMap version 31.56
                    Set OVERWRITE to true
                    Cigar strings enabled.
                    Set threads to 4
                    Retaining first best site only for ambiguous mappings.
                    No output file.
                    Exception in thread "main" java.lang.RuntimeException: Cannot read file /mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa
                            at align2.RefToIndex.makeIndex(RefToIndex.java:28)
                            at align2.BBMap.setup(BBMap.java:238)
                            at align2.AbstractMapper.<init>(AbstractMapper.java:56)
                            at align2.BBMap.<init>(BBMap.java:39)
                            at align2.BBMap.main(BBMap.java:28)
                    [zepper@zivsmp001 Pia]$ head /mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa
                    >Acta1_Mmi503488
                    TGCTGTACAGGTCCTTCCTGATGTCGGTTTTGGCCACTGACTGACCGACATCAAAGGACCTGTA
                    >Acta1_Mmi503489
                    TGCTGTCTGCATGCGGTCAGCGATACGTTTTGGCCACTGACTGACGTATCGCTCCGCATGCAGA
                    >Acta1_Mmi503490
                    TGCTGAAGAGCGGTGGTCTCGTCTTCGTTTTGGCCACTGACTGACGAAGACGACCACCGCTCTT
                    >Ahr_Mmi503972
                    TGCTGATTACAGGGAGCAAAGTTCTGGTTTTGGCCACTGACTGACCAGAACTTCTCCCTGTAAT
                    >Ahr_Mmi503973
                    TGCTGTATGGATGAGCTCATATACGCGTTTTGGCCACTGACTGACGCGTATATGCTCATCCATA

                    Comment

                    • GenoMax
                      Senior Member
                      • Feb 2008
                      • 7142

                      #55
                      Originally posted by Thias View Post
                      Hello Brian,

                      I need someone to give me a broad hint. I have already successfully indexed some eukaryotic genomes with BBMAP. But one PhD student in our lab has sequenced a custom shRNA library and I just wanted to use my usual aligner and just lower k-mer size. But it claims that it cannot read the FASTA with the reference sequences, although it is there. It there a lower limit of scaffold sizes (or a special parameter which I didn't set) which may cause BBMAP to abort with that error or is really the FASTA file somehow corrupted?

                      [CODE]
                      java -da -Xmx32g -cp /home/z/zepper/software/bbmap/current/ align2.BBMap build=1 overwrite=true match=long fastareadlen=500 ref=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa path=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/bbmap_index build=1 threads=4 -Xmx32g midpad=2000 k=5 minscaf=5
                      Executing align2.BBMap [build=1, overwrite=true, match=long, fastareadlen=500, ref=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa, path=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/bbmap_index, build=1, threads=4, -Xmx32g, midpad=2000, k=5, minscaf=5]
                      Perhaps because you are using both ref= and path= options?

                      Since you have pre-built the BBMap index you can just use path= to point to the indexes.

                      Comment

                      • Thias
                        Member
                        • Mar 2013
                        • 45

                        #56
                        @GenoMax: Thanks for your answer, but unfortunately this can't be the problem.

                        The folder in ref points to an empty directory, because I do not want to include the shRNA sequences to my regular set of indexed genomes. However the syntax with ref= and path= is exactly the syntax I used to successfully index the eukaryotic genomes before. (I used the standard k-mer size 13 and a midpad size of 200000 for the genomes though).

                        Comment

                        • Brian Bushnell
                          Super Moderator
                          • Jan 2014
                          • 2709

                          #57
                          Thias,

                          That specific error is triggered by:

                          File f=new File(reference);
                          if(!f.exists() || !f.isFile() || !f.canRead()){


                          So according to Java, either it does not exist, is not a file, or cannot be read. Perhaps the permissions are wrong, or the metadata on the file is wrong? It triggered before even looking inside the file, so the data is probably not corrupted.

                          You could technically do this:

                          cat /mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa |
                          java -da -Xmx32g -cp /home/z/zepper/software/bbmap/current/ align2.BBMap build=1 overwrite=true match=long fastareadlen=500 ref=stdin.fa path=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/bbmap_index build=1 threads=4 -Xmx32g midpad=2000 k=5 minscaf=5

                          ...which would circumvent Java trying to read the file. But I'd like to hear if you discover anything odd about the file permissions or metadata (like if it claims to be a directory, or something).

                          Comment

                          • WhatsOEver
                            Senior Member
                            • Apr 2012
                            • 215

                            #58
                            Dear Brian,

                            I'm coming with another problem (bug?), I cannot find an answer to. I run a RNAseq mapping with bbmap and got afterwards the following results:

                            Genome: 1
                            Key Length: 14
                            Max Indel: 200000
                            Minimum Score Ratio: 0.4
                            Mapping Mode: normal
                            Reads Used: 702748 (302588801 bases)

                            Mapping: 2780.014 seconds.
                            Reads/sec: 252.79
                            kBases/sec: 108.84


                            Read 1 data: pct reads num reads pct bases num bases

                            mapped: 98.1544% 689778 98.8899% 299229721
                            unambiguous: 96.8285% 680460 97.9391% 296352687
                            ambiguous: 1.3259% 9318 0.9508% 2877034
                            low-Q discards: 0.0011% 8 0.0001% 185

                            ...
                            As I don't like the samtools flagstat output, I wrote my own samfile-parser in order to compare the output of different mappers and different parameters used for mapping. From the samfile that was produced by bbmap, my parser returned the following

                            Found 762672 entries in the samfile.
                            Identified 702748 different reads.
                            663897 of the reads have unique mapping positions.
                            25881 of the reads have 85805 ambiguous mapping positions.
                            12970 of the reads did not map to the reference.
                            Elapsed seconds: 4
                            I verified these results by counting the individual bit-flags.
                            As this is quite different to your program output (except for the unmapped reads), I'm wondering were the mistake is?

                            Cheers,
                            W
                            Last edited by WhatsOEver; 06-03-2014, 06:03 AM.

                            Comment

                            • Brian Bushnell
                              Super Moderator
                              • Jan 2014
                              • 2709

                              #59
                              W,

                              I use the "XT:A:R" tag to indicate that a read is ambiguously mapped and XT:A:U to indicate unambiguously mapped. If you say "ambig=all" then the threshold for printing secondary alignments is more liberal than the threshold for deciding an alignment is ambiguous. So, even "unambiguously" aligned reads will sometimes have secondary sites printed - the best one, and others that are "decent" even though they are sufficiently worse than the best site that I classify the best site as unambiguous.

                              So if you add up all of the primary alignments with XT:A:U, you should get the same numbers as the program reports. Sorry that it's a custom tag (that is also used by bwa), but there's nothing in the official flag bits or official tags to indicate whether an alignment is ambiguous, and the SAM spec doesn't say anything about the presence of secondary alignments indicating ambiguity. It's really a subjective judgement.

                              Comment

                              • WhatsOEver
                                Senior Member
                                • Apr 2012
                                • 215

                                #60
                                Sorry, but I don't get it completely.

                                Originally posted by Brian Bushnell View Post
                                I use the "XT:A:R" tag to indicate that a read is ambiguously mapped and XT:A:U to indicate unambiguously mapped. If you say "ambig=all" then the threshold for printing secondary alignments is more liberal than the threshold for deciding an alignment is ambiguous. So, even "unambiguously" aligned reads will sometimes have secondary sites printed - the best one, and others that are "decent" even though they are sufficiently worse than the best site that I classify the best site as unambiguous.
                                What is your definition of an "unambiguously mapped read" if it has secondary alignments? If secondary alignments are printed as a result of a more liberal threshold, the read is no longer unambiguous under the used threshold, is it? This should be independent of how bad your sec alignments are, the chosen threshold shouldn't change the terminology, should it?
                                So in my case I have ~16K reads which are "unambiguous" according to your definition but have seconday alignments?

                                Originally posted by Brian Bushnell View Post
                                So if you add up all of the primary alignments with XT:A:U, you should get the same numbers as the program reports.
                                You are right - if I count XT:A:R, I get the same number as the program output (XT:A:U are however not visible/set?, but should of course be the remaining)

                                Originally posted by Brian Bushnell View Post
                                Sorry that it's a custom tag (that is also used by bwa), but there's nothing in the official flag bits or official tags to indicate whether an alignment is ambiguous, and the SAM spec doesn't say anything about the presence of secondary alignments indicating ambiguity. It's really a subjective judgement.
                                Yes, I know that and I really think that this is a confusing point in the SAM spec. But no, I don't think that it's a subjective judgement just because the word "ambiguity" is not explicitly used in the specs.
                                Or is it just my german misinterpretation of the strictness in the word ambiguity?

                                But being aware of that also helps, thanks again Brian for a fast and helpful response. I will now stop my work on mapper-evaluation for my projects and focus on the next steps - so I won't bother you with additional things in the next time

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                                  by SEQadmin2


                                  Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                                  The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                                  ...
                                  Yesterday, 10:05 AM
                                • SEQadmin2
                                  Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
                                  by SEQadmin2


                                  With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


                                  Introduction

                                  Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
                                  05-22-2026, 06:42 AM
                                • SEQadmin2
                                  Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
                                  by SEQadmin2

                                  Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


                                  Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
                                  05-06-2026, 09:04 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 12:03 PM
                                0 responses
                                19 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, Yesterday, 11:40 AM
                                0 responses
                                14 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 05-28-2026, 11:40 AM
                                0 responses
                                29 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 05-26-2026, 10:12 AM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...