Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • kevluv93
    Member
    • Jun 2014
    • 10

    @mastal

    Thank you for the quick reply! Unfortunately, it's still displaying the same error message. But at least I know the problem is around there, so that's good news.

    So, could there be a way to possibly direct trimmomatic to the file without beginning with C:? Or could this possibly be another issue?

    I've tried other symbols like brackets and parenthesis just in case 'C:' wasn't it. Same message.

    Comment

    • usad
      Member
      • Sep 2009
      • 53

      Hi

      sorry for the inconvenience. At the moment it might be best to not have to use C: at all as trimmomatic looks for data after :
      E.g. having the clip file in the actual directory - yukk.

      Best Wishes
      Björn

      Comment

      • kevluv93
        Member
        • Jun 2014
        • 10

        I figured it would come to that. I think my best option would be to use Linux and not have to direct trimmomatic using "C:". Don't file paths in Linux all begin with a "/home/..."? I'll try that and see if it works.

        Comment

        • Brian Bushnell
          Super Moderator
          • Jan 2014
          • 2709

          Originally posted by kevluv93 View Post
          I figured it would come to that. I think my best option would be to use Linux and not have to direct trimmomatic using "C:". Don't file paths in Linux all begin with a "/home/..."? I'll try that and see if it works.
          No, not really. The path depends on the system... Java works fine in Windows, and as long as the classpath is set correctly, it should work fine anywhere. You just need to set the "-cp" variable correctly.

          Comment

          • tsangkl
            Member
            • Jun 2014
            • 13

            Originally posted by mastal View Post
            What was the trimmomatic command that you used, and what sequences did you use in the adapters fasta file?
            java -jar trimmomatic-0.32.jar PE -threads 11 -trimlog trim_keepbothread.log Hiseq_1.fastq Hiseq_2.fastq Hiseq_1_keeppaired.fastq Hiseq_1_keepunpaired.fastq Hiseq_2_keeppaired.fastq Hiseq_2_keepunpaired.fastq ILLUMINACLIP:NexteraPE-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

            And my adapter fasta file contain the transposase sequence and primer sequence provided by illumina:

            >Trans1_rc
            CTGTCTCTTATACACATCTGACGCTGCCGACGA
            >Trans2_rc
            CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

            >Primerprefixi5_rc
            GACGCTGCCGACGA
            >Primerprefixi7_rc
            CCGAGCCCACGAGAC


            Thanks

            Comment

            • kevluv93
              Member
              • Jun 2014
              • 10

              Could you guys give me an example script of setting up a classpath for "ILLUMINACLIP:" to get access to the adapter files in the trimmomatic binary download? I should probably mention that my experience with scripting languages begins and ends with "making stick figures in JavaScript", so forgive me if I'm asking for baby steps. I'm still using Windows 8 for this trimmomatic job (it's the OS that all the computers in our college use, so I don't really have a choice.)

              @ Bjorn, you mentioned "having the clip file in the actual directory", and that trimmomatic looks for documents after ":". With this info, I deleted the "C:" that came after ILLUMINACLIP: but I got an error message telling me, "ArrayIndexOutOfBoundsException: 1".

              @Brian Bushnell, you mentioned that trimmomatic will work on windows as long as I specify the classpaths to the files correctly.

              So, could someone give me an example of what I need to write after "ILLUMINACLIP:" to let "ILLUMINACLIP:" get the adapter sequence fa. files that are saved on my desktop? I'm just right clicking these icons and copy/pasting their locations into the trimmomatic script. How else does one make a path to a file?

              Thanks for the help! Any input is appreciated!

              Comment

              • Brian Bushnell
                Super Moderator
                • Jan 2014
                • 2709

                kevluv,

                You are not doing anything wrong with Java; your command would fail in any environment. The classpath appears to be correct, you just have the wrong command line.

                Comment

                • MikhailFokin
                  Member
                  • Mar 2014
                  • 15

                  Hi guys, seems that Trimmomatic is very useful and performs better that others.

                  The only thing I can not find, if present at all. Where can I get the info if any adaptor clipping appeared? Yes I can analyse the result by fastqc or go deep to log (still no info for clipping), but is there any obvious place to find adaptor clipping results?

                  The second question is - what is the clipping/trimming strategy applied for internal (junction Nextera adaptors)?

                  Comment

                  • MikhailFokin
                    Member
                    • Mar 2014
                    • 15

                    could you please give a real example of using -baseout flag?
                    when using like this "... -phred33 PE S1R1.fatsq S1R2.fastq -baseout outS1.fasta ILLUMINACLIP..." it is still trying to find the list on names afterwards...

                    Comment

                    • kevluv93
                      Member
                      • Jun 2014
                      • 10

                      Haha! I finally got it to work! It was just some user error on my part.

                      Changes:
                      Don't use "C:" at the beginning of files.
                      It works fine with Windows 8
                      I erased the ".fq" at the end of my input files, I thought I was supposed to specify what file type my input data was, but don't. The name of the file's good enough.

                      Worked like a charm, it was just user error on my part. Thanks for the help!

                      Comment

                      • usad
                        Member
                        • Sep 2009
                        • 53

                        great that it works now.

                        Comment

                        • BFM
                          Member
                          • Jun 2014
                          • 10

                          Hi i have used trimmomtaic to clip the adapter sequences. Yet i am still having a problem with kmers, sequence per base content. My question is how do we improve the quality if there is any failure in Fastqc results????

                          Comment

                          • kevluv93
                            Member
                            • Jun 2014
                            • 10

                            Hi, back again. When I use trimmomatic I get abnormally high Kmer reads on FastQC, I read out the Kmers and realized that most of my forward adapter was still inside of my cDNA.

                            I opened the TruSeq2 adapter file and realized that the Prefix PE/1 adapter (I guess that means the forward adapter?) Didn't match the forward adapter I was using, which is:
                            TruSeq Adapter, Index 2
                            5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG

                            So I went in and replaced the default forward adapter with the sequence you see above.

                            Now I have another issue, for some reason trimmomatic has managed to cut 8GB of data into 2GB of data. (if I combine the forward and reverse paired and unpaired files) Fastqc is giving me Kmers that are similar to my sequence, and when I opened the forward paired file I saw that fairly large chunks of my primers are still at the 3' end of my cDNA.

                            ex.
                            GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
                            GATCGGAAGAGCACACGTCTGAACTCC
                            ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGA

                            They're just small enough for trimmomatic to miss. Is there any helpful suggestions you can give me regarding the settings of trimmomatic to help me cut these small bits of adapters off the end of my reads? Is there a reason why only small fragments of my adapter sequences would be left after using trimmomatic? Finally, is it usual for such a large portion of data to get cut when using trimmomatic or am I screwing this up? (8GB to 2GB of data)

                            Comment

                            • tonybolger
                              Senior Member
                              • Feb 2010
                              • 156

                              Originally posted by kevluv93 View Post
                              Hi, back again. When I use trimmomatic I get abnormally high Kmer reads on FastQC, I read out the Kmers and realized that most of my forward adapter was still inside of my cDNA.

                              I opened the TruSeq2 adapter file and realized that the Prefix PE/1 adapter (I guess that means the forward adapter?) Didn't match the forward adapter I was using, which is:
                              TruSeq Adapter, Index 2
                              5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
                              This sequence looks like a TruSeq-3 adapter - if so, either the TruSeq3-PE or TruSeq3-PE-2 adapter files should remove the sequencing adapters. The useful part of the reads should survive if they the adapters are in the normal position.

                              If you do have any surviving adapters, can you post a few examples?

                              Thanks,

                              Tony.

                              Comment

                              • Mchicken
                                Member
                                • Jan 2014
                                • 39

                                Hey guys,
                                i`ve got some problems with Trimmomatic:

                                I have the following 100bp long read:

                                @HWI-ST365:34625ECACXX:5:1101:3183:2046 1:N:0:TGACCA
                                NCAGGGGGAACAGGCTGATCTCCCCCAAGAGTCCACATCGACGGGGAGGTTTGGCACCTCGATGTCGGCTCATCGCAACCTGGGGCGGAAGGACGTCCCC
                                +
                                #11A?DDDHHBBF?FHBGCGHGGDD@FFDDD9B@FHD8)<FHIG8B89>(,5,5(::<CB?'9@BC8;5?##############################

                                I only run SLIDINGWINDOW:4:15 on this read

                                and what i get is:

                                Log-File:

                                HWI-ST365:34625ECACXX:5:1101:3183:2046 1:N:0:TGACCA 52 0 52 48

                                trimmed fastq:

                                @HWI-ST365:34625ECACXX:5:1101:3183:2046 1:N:0:TGACCA
                                NCAGGGGGAACAGGCTGATCTCCCCCAAGAGTCCACATCGACGGGGAGGTTT
                                +
                                #11A?DDDHHBBF?FHBGCGHGGDD@FFDDD9B@FHD8)<FHIG8B89>(,5


                                But when i run my own script on the read i can see that the pattern (,5, beginning at position 50 has an average quality of 12.25, which is below the required 15. So the read should survive from position 1 to 49 and not until position 52 as determined by Trimmomatic.

                                So can anyone tell me where i am wrong?

                                Thanks
                                Mchicken

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                34 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                217 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                81 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...