Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • kinurev
    Junior Member
    • May 2013
    • 2

    #31
    pmiguel, do you think spike in with 5% PhiX library works for Ktu application because he is using a custom sequencing primer which will not sequence from the PhiX library. The effect of PhiX spike-in in this case is just lower the cluster density his transposon library.

    Besides, if you still have to spike-in >5% of high complexity library or run a control lane then "the issue" is not completely solved, is it?

    Cheers,

    Comment

    • GenoMax
      Senior Member
      • Feb 2008
      • 7142

      #32
      Originally posted by dcnadler View Post
      Can you give a little more detail on the software changes that improve runs with low-complexity libraries (assuming you spike in >= 5% high-complexity DNA)? Or point to the thread that discusses this change?

      Based on the software release notes, I am guessing it has something to do with the color matrix estimation method changing? But I do not have enough expertise on these methods to be sure.

      thanks!
      Here is the tech note from Illumina about this topic: http://www.illumina.com/documents/pr...ersity_RTA.pdf

      Comment

      • Ktu
        Junior Member
        • Apr 2013
        • 7

        #33
        Originally posted by kinurev View Post
        pmiguel, do you think spike in with 5% PhiX library works for Ktu application because he is using a custom sequencing primer which will not sequence from the PhiX library. The effect of PhiX spike-in in this case is just lower the cluster density his transposon library.

        Besides, if you still have to spike-in >5% of high complexity library or run a control lane then "the issue" is not completely solved, is it?

        Cheers,
        Hi kinurev,

        In the case of nextera XT, you don't need the PhiX.
        i don't understand what is the complexity library concretely.

        Comment

        • dcnadler
          Junior Member
          • May 2013
          • 3

          #34
          Originally posted by GenoMax View Post
          Here is the tech note from Illumina about this topic: http://www.illumina.com/documents/pr...ersity_RTA.pdf
          Thank you! This is exactly what I was looking for.

          Comment

          • charel
            Junior Member
            • Dec 2012
            • 2

            #35
            custom sequencing primer design

            Good evening,

            I have posted a question a little while back in this thread concerning Tm of custom sequencing primers.

            Now coming back to the issue, I am still battling with their design, especially as I can not explain how the Illumina or the Fluidigm sequencing primers work considering their Tm (see attached table no 1-4). IDT's OligoAnalyzer seems to predict a Tm for these sequences much lower than what is recommended in this thread, i.e. >70ºC; especially the Fluidigm primers are a puzzle to me. As Fluidigm is using LNA bases I have also checked the Tm on the Exiqon website (provider of LNA oligos) and for the same sequences I see much higher values. I believe that this can be explained by the fact that Exiqon uses an Na+ concentration of 115 mM as opposed to IDT with only 50 mM. What salt concentration do we have in the HT1 buffer? In other words what Tm predictor is relevant here?

            Taking these observations to the design of my sequencing primers (also in the attached table no 5-7 and pasted below) I wonder what option is best. I am now considering to spike them in including some LNA bases. Where should I put them? How many? In the Fluidigm primers they are a the 5' end; Why? As an alternative to LNA I have designed number 7, a longer version of number 5, I have just extended it into the P5 adapter region. Is that a feasible approach? Which design would you go for and/or what modifications would you suggest, or should I just give it a try?

            >Mine forward short (no.5)
            CACGCTCGAGGAAAGAAAAATATAGGCGCGCCA
            >Mine reverse (no.6)
            GAGTCAGCAGCGAATTGGAGCTCTAGCTACCTA
            >Mine forward long (no.7)
            TACGGCGACCACCGAGGCACGCTCGAGGAAAGAAAAATATAGGCGCGCCA


            Many thanks,

            Charles.
            Attached Files

            Comment

            • pmiguel
              Senior Member
              • Aug 2008
              • 2328

              #36
              You would need to account for the LNA bases in your Tm calculations for the Fluidigm primers. They probably put the LNA bases near the 3' end because, to a first approximation, those are the critical bases for the polymerase. If they anneal, the polymerase can extend. If they don't anneal the polymerase will have difficulty extending.

              I don't know what the salt concentration in HT1 is. ECO would probably know.

              The main trick, I think, in this case is that there is basically no down side to making the primers as long as possible. Remember this is surface-bound PCR/primer extension. Many of the issues with getting exactly the right Tm have to do with specificity. But since the surface-bound nature of these reactions nearly eliminates template competition, I don't see a problem with just going as long as possible.

              --
              Phillip

              Comment

              • TonyBrooks
                Senior Member
                • Jun 2009
                • 303

                #37
                We've done a couple of runs now with a custom primer and got poor results - very dim clusters. We believe the first run had a read primer with Tm that was too low (60C by OligoAnalyzer) so we redesigned by adding some additional P5 bases onto the 5' end and raising Tm to ~66C and ran the same library again with the same result.
                We spike the custom primer into the read 1 mix (low diversity library, so 5% PhiX is spiked in). The PhiX clusters are perfect. Has anyone seen this?
                We were wondering whether to increase the concentration of the custom primer from the recommended amount, or maybe running the custom primer on its own and hoping for enough diversity (at least we can check whether we have decent first cycle intensity).
                It's times like this I actually miss the GAIIx (shock, horror!!). At least you could run one cycle and play with primer-rehybs until you got it right.

                Comment

                • pmiguel
                  Senior Member
                  • Aug 2008
                  • 2328

                  #38
                  Hi Tony,
                  I don't think there is any downside to making your primers longer than necessary. It isn't like you are trying to distinguish between slightly different sequences with them.

                  --
                  Phillip

                  Comment

                  • RCJK
                    Senior Member
                    • May 2009
                    • 156

                    #39
                    Hi Tony,
                    I know it's been a while, but have you been able to resolve your issue with the dim clusters? If so, what did you do to resolve the issue?
                    Thanks!

                    Comment

                    • TonyBrooks
                      Senior Member
                      • Jun 2009
                      • 303

                      #40
                      Yes, although we needed to redesign the assay to use a different priming site.

                      Comment

                      • RCJK
                        Senior Member
                        • May 2009
                        • 156

                        #41
                        Hi Tony,
                        Thanks for the response. Did you need to change the sequencing primers, or did you use completely different target primers for your initial PCR?
                        I'm seeing a similar thing with a set of primers we are testing, bright PhiX clusters, dim amplicon clusters. Low signal intensity and low %PF, but the index read seems to sequence well. We are using a design based on the EMP protocol, but with a different target locus.

                        Comment

                        • windhorse8
                          Member
                          • May 2011
                          • 18

                          #42
                          Originally posted by kcchan View Post
                          Ktu, please re-read this thread carefully. The sequencing primers has already been posted by pmiguel. The Illumina provided primers are actually a pool of several different primers, but their characteristics are all fairly similar.
                          But what about P5 and P7 sequence for Miseq. If I understand correctly, the actual P5 and P7 sequences attached on flow cells are different between Hiseq and Miseq. I also need to make library using custom primer. But I am still confused in terms of what exactly the sequences of P5 and P7 have to be for cluster generation on Miseq.
                          Any references or publications ?
                          Thanks

                          Comment

                          • windhorse8
                            Member
                            • May 2011
                            • 18

                            #43
                            Originally posted by ZAAB View Post
                            We use a plethora of custom sequencing primers for the MiSEQ, and we shoot for 75-80 degrees Tm...I have not tested lower Tm primers, not worth the risk. We just pay for the longer oligo synthesis, which is still cheaper than a failed MiSEQ run.
                            Hi ZAAB,
                            Are there any other unique specifications to be followed for the synthesis of custom primers beside Tm such as requirements for HPLC/PAGE purifications or inclusion of phosphorothioate bonds in the primers ? My primer lengths are 50 and 64 respectively.

                            Best,
                            windhorse8

                            Comment

                            • Xaki
                              Junior Member
                              • Oct 2015
                              • 4

                              #44
                              Hi all,
                              I just found this thread and see that it is closely related to mine where I'm asking by how much custom sequencing primers can overlap with the anchors on the flow cell.
                              A suggested by others here, theoretically there should be no problems overlapping entire flow cell adapter, but I see no one with direct (positive) experience doing this.
                              So maybe people here already found a definite answer to this question? Please share if you have one. Thanks

                              Comment

                              Latest Articles

                              Collapse

                              • mylaser
                                Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by mylaser
                                Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                                If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                                This guide explains everything you need to know about...
                                Yesterday, 01:13 AM
                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              22 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              14 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              32 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-02-2026, 11:08 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...