[francois.sabot]

Hi guys
I have also the same error. However my data are pure solexa, not solid, so no colour to base space transition is requested.

Maybe another problem ?

[javijevi]

Hi guys
I have also the same error. However my data are pure solexa, not solid, so no colour to base space transition is requested.

Maybe another problem ?

As far as I know, if you use fastq files the problem is the same: you've got a wrong fastq file.

[francois.sabot]

Ok... Meaning that Illumina pipe (Gerald...) doesn't provide correct fastq data formatting :s

[javijevi]

Ok... Meaning that Illumina pipe (Gerald...) doesn't provide correct fastq data formatting :s

At least not correct enough for bwa pipeline, it seems. If you have the corresponding FASTA and QUAL files, you can try some script to producing fastq files from them. In the case of SOLiD data, the last solid2fastq.pl script provided in this thread worked perfect for me, but it is for color space reads. I do not know about similar tools for nucleotide space (not color space) reads.

[Lisa]

Hi Everyone,
I am a newbie for Illumina data analysis. I had a segmentation fault too. Here is how I got this error.

I first converted Illumina sequence file to Sanger quality fastq and run bwa aln to create .sai without any problem.

Then I ran bwa sampe to get the following error:

[bwa_read_seq] 0.0% bases are trimmed.
[bwa_read_seq] 0.0% bases are trimmed.
[bwa_sai2sam_pe_core] convert to sequence coordinate...
Segmentation fault

My server is 16G RAM and had 12G available at that moment.

What could be the problem for this kind of segmentation fault? Any suggestion or comments would be absolutely appreciated!

Lisa

[javijevi]

Hi Everyone,
I am a newbie for Illumina data analysis. I had a segmentation fault too. Here is how I got this error.

I first converted Illumina sequence file to Sanger quality fastq and run bwa aln to create .sai without any problem.

Then I ran bwa sampe to get the following error:

[bwa_read_seq] 0.0% bases are trimmed.
[bwa_read_seq] 0.0% bases are trimmed.
[bwa_sai2sam_pe_core] convert to sequence coordinate...
Segmentation fault

My server is 16G RAM and had 12G available at that moment.

What could be the problem for this kind of segmentation fault? Any suggestion or comments would be absolutely appreciated!

Lisa

Hi, Lisa. As you can see in previous posts, it seems to be related to a wrong construction of the fastq file by the solid2fastq (or similar) script. At least in my case, using the last solidfastq provided by last post of user 'lh3' in this thread solved the problem.

Cheers,

[Lisa]

Thanks a lot for your reply. Do you or anyone else know solid2fastqq is working for Illumina sequence files? or are there some scripts of Illumina2fastq.

Thanks.

Lisa

[Lisa]

One more question. I don't have problem to run bwa aln, but got problem to run bwa sampe. Could that be some other reasons other than fastq format?

Thanks in advance!

Lisa

[francois.sabot]

After tests on the 0.5.6 version, I still have the same problem... In the bio-bwa mailing list, Heng Li (lh3 user here) proposed me to try my data (ref and reads) to check where is the problem... As the fastq file was constructed using the official Illumina softwares (by integragen company), it could be nice to adapt someway bwa or to know what to do before running bwa to ensure a correct mapping with these type of data. Most of people that will use illumina data do not know at all how to reconfigure the fastq file itself...

EDIT: after few research on my own side, as the dmesg is 'bwa[21956]: segfault at 0 ip 00007fc4cf69bc63 sp 00007fff11af84a8 error 6 in libc-2.10.1.so[7fc4cf61a000+166000]', it is possible that the error is linked to the libc6 version too... How to correct it ??

[yenhuahuang1]

colour space alignment, reverse complement, and deletions in alignments

You may try solid2fastq.pl here. The "-1" issue should be resolved, although I have not tested this on real data and I do not know if segfault is caused by other issues.

http://bio-bwa.svn.sourceforge.net/viewvc/bio-bwa/trunk/bwa/solid2fastq.pl?revision=29

In addition, there are bugs in bwa-0.5.5. You'd better use the SVN version, which will become 0.5.6 in the near future.

In my case I found two issues when using BWA:

- the quality string length is inconsistent with that of the sequence string when there are deletions in the alignment.

e.g.
solid_20091208_XX_SureSelect_6505all_exon_:879_1653_1194 16 11 56020361 0 2S6M1D40M * 0 0 CCAGAAGAGAAACACCCAAGATAACTCTATCAGTGATAGGACTAACAG : XT:A:R CM:i:1 X0:i:2 X1:i:0 XM:i:2 XO:i:1 XG:i:1MD:Z:6^A40


- In the colour space alignment of a reverse and complement read, the BWA output sequence in the sam file will be complement (but not reverse) to the reference sequence (the human genome GRCh37).

e.g.
solid_20091208_XX_SureSelect_6505all_exon_:853_23_233 16 7 107877340 25
48M * 0 0 CACGTTTTGACCACCGAAGTCTCCGTCTCGAAGATAAGTGTCCAGACG
R;8J]]L<>K]NCO]]O,(Q]TJ@N]TPQW]L<R]]MC@O]]Y]YHPR XT:A:U CM:i:1 X0:i:1 X1:i
:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:7T40

Have these issues been resolved in the SVN version? Many thanks.

[seq_GA]

Hi,
I am also trying to map about 12 million Illumina reads against human genome. bwa-0.5.6 version.

I could do ./bwa aln ....

But I get segmentation fault when I try to use ./bwa samse command. My input file is sequence.txt in fatsq format that comes from Solexa pipeline. How do I overcome this problem? Thanks.

[francois.sabot]

Hi,
I am also trying to map about 12 million Illumina reads against human genome. bwa-0.5.6 version.

I could do ./bwa aln ....

But I get segmentation fault when I try to use ./bwa samse command. My input file is sequence.txt in fatsq format that comes from Solexa pipeline. How do I overcome this problem? Thanks.

What is your system ? Can you send the terminal output when you type 'dmesg' after the Seg fault ?

[javijevi]

You may try solid2fastq.pl here. The "-1" issue should be resolved, although I have not tested this on real data and I do not know if segfault is caused by other issues.

http://bio-bwa.svn.sourceforge.net/viewvc/bio-bwa/trunk/bwa/solid2fastq.pl?revision=29

I think I've found a minor bug in an error message raised by solid2fastq.pl script distributed with bwa when it founds a mismatching name in the .csfasta and .qual input files:

The following line

die(qq/** unmatched read name: '$_' != '$_'\n/) unless ($_ eq $t);

must be

die(qq/** unmatched read name: '$_' != '$t'\n/) unless ($_ eq $t);

[yenhuahuang1]

solid2fastq.pl: The first -1 in the quality line is not resolved yet.

You may try solid2fastq.pl here. The "-1" issue should be resolved, although I have not tested this on real data and I do not know if segfault is caused by other issues.

http://bio-bwa.svn.sourceforge.net/viewvc/bio-bwa/trunk/bwa/solid2fastq.pl?revision=29

In addition, there are bugs in bwa-0.5.5. You'd better use the SVN version, which will become 0.5.6 in the near future.

The new solid2fastq.pl may not be working when the first quality value is -1. I suggest that the order of the following two lines should reversed.

=========
s/^(\d+)\s*//;
s/-1\b/0/eg;
=========

[Azazel]

convert to sequence coordinate... Segmentation fault

I am using bwa Version: 0.5.8 (r1442) on CentOS, a machine with lots of RAM.

I downloaded the unmasked mouse genome from

http://hgdownload.cse.ucsc.edu/goldenPath/mm9/bigZips/chromFa.tar.gz

I then created an index for bwa like this:

bwa index -a bwtsw mm9.fa

I then aligned my illumina short reads agains the genome and get sai files. My goal is bed files, so I want to convert sai -> sam -> bam -> bed to get there.

When I try to convert from sai to sam like this:

bwa samse SOMEPATH/mm9.fa stuff.sai stuff.fq > stuff.sam

I get:
convert to sequence coordinate... Segmentation fault

But, I have done the very same procedure with different illumina short read sequences (even higher amount of data) for a different organism (rat), and it went OK.

Any help would be very much appreciated. (I am afraid I am not able to patch bwa, though)