Tweet
Originally posted by nucacidhunter
View Post
I will send more sequencing metrics.
-
i am new in this field. can anyone tell me how to check the cluster density. just in case this is casued by amplicon diversity issue， is there any trick to aviod this problem happens again. thank you guys so much！
I will send more sequencing metrics. -
Read1
[IMG]
[/IMG]
Comment
-
Comment
-
read2
Comment
-
in this library,i use the custom sequencing primersOriginally posted by nucacidhunter View Post
P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCComment
-
Originally posted by dalin View Post
After these FastQC reports and your explanation, the issue should not be generated by over-clustering.
As nucacidhunter said, you may give more info for trouble shoot, like listed below:
(1) What/which protocol/kit for library construction?
(2) Adapter system you used? e.g. Nextera or TruSeq LT, if you used custom primers / adaptors, please give intact sequences of them, cannot recognize "the sequencing primers" you provided.
(3) Sequencing run type you used? eg. V3 high output run of HiSeq PE100.
(4) % of PhiX spike-in?Comment
-
I wait with bated breath. This is the most terrible run I have ever seen! It looks to me like it ran out of reagent after 100 cycles, but I'm betting on nucacidhunter for diagnosing it correctly.Comment
-
Thanks for reply, In this library,i only PCR amplification for about 19 cycles......Originally posted by Brian Bushnell View PostComment
-
in this library,i use the custom sequencing primersOriginally posted by weigrc View Post
P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
With the custom sequencing primers, the library sequence is
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT--NNNNNNNNNNNNNNNNNNNN------GTCGGAGAATTCCTTACTAGTAGAACTCTGTTCTTGAGCTAGCATCGATGCTAGCTCAAGAACAGAGTTCTACTAGTAAGGAATTCTCCGAC----NNNNNNNNNNNNNNNNNNNN---GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
thanks a lot!Comment
-
From provided information I assume that your library insert size is around 130 bp with middle 90 bases being the same in all inserts and flanking 5' and 3' 20 bases divergent. The library structure contains truncated universal LT P5 and index1 P7 adapter with additional bases. Considering the position of P5 deletion and P7 addition this library should be suitable for sequencing with standard MiSeq reagents. Read1 sequence quality drops below 30 around 60th cycle which is below expected for 100 cycle sequencing. I would suggest that read2 low quality has been caused either by a fault in sequencer or MiSeq reagents. Reagents could have been faulty or used past expiry date or recommended handling has not been followed.
You have not mentioned the library prep method, but the data suggests that mid sequences of insert are not exactly the same.Comment
-
Thank you very much,the 5 and 3 flanking divergent sequence are accually 19-21 bp（probally mainly 20）,we used hiseq 2000. other lines in this run looks fine. so it may not likely caused by reagent.Originally posted by nucacidhunter View Post
you suggest help me a lot, thank you!Comment
-
I'm sorry i don't know the cluster density of the library. The Sequencing company have no information for the cluster density. teatv spice money loginLast edited by ashleylose07; 08-21-2021, 02:11 AM.Comment
-
Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.
The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...06-02-2026, 10:05 AM -
With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.
Introduction
Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...05-22-2026, 06:42 AM -
Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.
Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...05-06-2026, 09:04 AM
Comment