Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • skmotay
    Member
    • Oct 2014
    • 29

    FastQC, Kmer count, Trimmomatic: no success in trimming, still fail Kmer

    I'm using RNAseq for DGE and failed in trying to map paired end reads in TopHat2. Samples passed the first two parts of fastqc, but failed per base and Kmer count. Some samples did pass per base.

    I tried trimming them to remove adaptors, but nothing improved the Kmer plot. http://imgur.com/Fhbx534 All of the kmer plots from this data set (18) look similar. I used the adaptor settings built into trimmomatic, but none worked. I then emailed genewhiz and asked for their (truseq) adaptors, but trimming for those sequences didn't improve the plots.

    Ex per seq quality score http://imgur.com/5L5PaJU,Hg2mHk0#0
    per base http://imgur.com/5L5PaJU,Hg2mHk0#1

    Am I doing something wrong? Should I just trim everything across certain bases?

    Edit: reads are paired

    adaptor input file:
    >PrefixPE
    GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
    >Prefix PE
    AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
    Last edited by skmotay; 10-09-2014, 06:22 AM. Reason: links for images
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    Are your reads paired? If so, you can trim them with BBDuk via overlap, without specifying the adapter sequence, like this:

    bbduk.sh in1=r1.fq in2=r2.fq out1=trimmed1.fq out2=trimmed2.fq tpe tbo

    That package comes with both TruSeq and Nextera adapters, which are another possibility that you can try.

    Comment

    • skmotay
      Member
      • Oct 2014
      • 29

      #3
      Yes, reads are paired.

      I think I should have mentioned that I'm working in Galaxy, which I think limits what tools I can use. I don't see BBDuk in my tools.

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        Ah, too bad. I'll see if I can get BBTools put into Galaxy. Though you can still download it and try out the Nextera adapter file. I would recommend, though, that you contact the source of the data to find out what kind of adapters were actually used - that will save a lot of time.

        Comment

        • skmotay
          Member
          • Oct 2014
          • 29

          #5
          I emailed genewhiz and they sent me the adaptor sequences (listed I original post). I'm not quite sure I wrote the adaptor sequence file correctly and I couldn't find a clear example.

          Comment

          • avo
            Member
            • Sep 2013
            • 14

            #6
            Does Fastqc give you a warning for overrepresented sequences?

            I don't know the default -k setting for fastqc but maybe it helps to increase it.
            My impression is that the adapter trimming worked. But the overrepresented k-mers test fails due to other reasons

            Comment

            • skmotay
              Member
              • Oct 2014
              • 29

              #7
              They all pass overrepresented sequences.

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                Today, 11:10 AM
              • SEQadmin2
                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                by SEQadmin2



                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                Yesterday, 05:17 AM
              • GATTACAT
                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by GATTACAT
                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                07-01-2026, 11:43 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, Today, 10:04 AM
              0 responses
              8 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, Yesterday, 10:08 AM
              0 responses
              6 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-07-2026, 11:05 AM
              0 responses
              9 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-02-2026, 11:08 AM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Working...