Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • KevinLam
    Senior Member
    • Nov 2009
    • 204

    MAPQ must should be 0 for unmapped read

    Hi I am not too sure what to make of this.
    the sam file was from bwa
    is it a bug in bwa output?

    java -Xmx2g -jar /home/corona/bin/source/picard-tools-1.14/ViewSam.jar INPUT=sorted.sam ALIGNMENT_STATUS=Aligned > sortedaligned.sam


    Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. MAPQ must should be 0 for unmapped read.; File sorted.sam; Line 8910023
    Line: ./S2:747_1696_219 4 chr18 90771994 25 48M * 0 0 AGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGTTTGGGGCTT ]]]]]]PLQ]]XW[]QA6H]]VI+3]M9FSIFG@QQ:!)]0+OJRL:7 XT:A:U CM:i:1 XN:i:10 X0:i:1 X1:i:0 XM:i:4 XO:i:0 XG:i:0 MD:Z:40C7
    at net.sf.samtools.SAMTextReader.reportErrorParsingLine(SAMTextReader.java:176)
    at net.sf.samtools.SAMTextReader.access$500(SAMTextReader.java:40)
    at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:385)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:232)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:196)
    at net.sf.picard.sam.ViewSam.doWork(ViewSam.java:68)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:143)
    at net.sf.picard.sam.ViewSam.main(ViewSam.java:58)
    http://kevin-gattaca.blogspot.com/
  • mard
    Member
    • Jan 2010
    • 21

    #2
    I am getting a similar error with Picard ValidateSamFile.jar after running bwa 0.5.6...


    $ java -Xmx4g -jar picard-tools-1.14/ValidateSamFile.jar INPUT=IC201N.sam

    [Tue Mar 09 11:35:57 EST 2010] net.sf.picard.sam.ValidateSamFile INPUT=IC201N.sam MODE=VERBOSE MAX_OUTPUT=100 IGNORE_WARNINGS=false TMP_DIR=/var/folders/zK/zKWfvkbvHui1XRNLQFGiFrpceyw/-Tmp-/mard VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000
    ERROR: Read groups is empty
    ERROR: Record 115632, Read name HWUSI-EAS715_100113:3:4:917:341#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 115632, Read name HWUSI-EAS715_100113:3:4:917:341#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 179735, Read name HWUSI-EAS715_100113:3:6:472:1636#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 179735, Read name HWUSI-EAS715_100113:3:6:472:1636#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 1944399, Read name HWUSI-EAS715_100113:3:59:1626:1079#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 1944399, Read name HWUSI-EAS715_100113:3:59:1626:1079#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 2044255, Read name HWUSI-EAS715_100113:3:63:461:1816#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 2044255, Read name HWUSI-EAS715_100113:3:63:461:1816#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 2173246, Read name HWUSI-EAS715_100113:3:67:1075:709#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 2173246, Read name HWUSI-EAS715_100113:3:67:1075:709#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 2174105, Read name HWUSI-EAS715_100113:3:67:1125:1723#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 2174105, Read name HWUSI-EAS715_100113:3:67:1125:1723#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 2663210, Read name HWUSI-EAS715_100113:3:83:1248:281#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 2663210, Read name HWUSI-EAS715_100113:3:83:1248:281#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 3064036, Read name HWUSI-EAS715_100113:3:96:383:1101#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 3301642, Read name HWUSI-EAS715_100113:3:103:698:837#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 3301642, Read name HWUSI-EAS715_100113:3:103:698:837#0, CIGAR should have zero elements for unmapped read.
    ERROR: Record 3718533, Read name HWUSI-EAS715_100113:3:115:843:1180#0, MAPQ must should be 0 for unmapped read.
    ERROR: Record 3718533, Read name HWUSI-EAS715_100113:3:115:843:1180#0, CIGAR should have zero elements for unmapped read.
    [Tue Mar 09 11:36:26 EST 2010] net.sf.picard.sam.ValidateSamFile done.
    Runtime.totalMemory()=84475904


    Turns out that the first read from above maps off the end of the reference chromosome...

    Ref# CAGAGGCGGCGGCTCGGGGAGAAACCTCAGGCACGGCCGGGCCACCAGGAAAACACGGCCGCGGGATC <- end of chromosome
    Read CGGGGGCGGCGGCTCGGGGAGAAACCTCAGGCACGGCCGGGGCACCAGGAAAACACGGCCGCGGGATCCCA

    So is this a bug in bwa?

    Comment

    • nilshomer
      Nils Homer
      • Nov 2008
      • 1283

      #3
      Originally posted by mard View Post
      I am getting a similar error with Picard ValidateSamFile.jar after running bwa 0.5.6...


      $ java -Xmx4g -jar picard-tools-1.14/ValidateSamFile.jar INPUT=IC201N.sam

      [Tue Mar 09 11:35:57 EST 2010] net.sf.picard.sam.ValidateSamFile INPUT=IC201N.sam MODE=VERBOSE MAX_OUTPUT=100 IGNORE_WARNINGS=false TMP_DIR=/var/folders/zK/zKWfvkbvHui1XRNLQFGiFrpceyw/-Tmp-/mard VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000
      ERROR: Read groups is empty
      ERROR: Record 115632, Read name HWUSI-EAS715_100113:3:4:917:341#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 115632, Read name HWUSI-EAS715_100113:3:4:917:341#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 179735, Read name HWUSI-EAS715_100113:3:6:472:1636#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 179735, Read name HWUSI-EAS715_100113:3:6:472:1636#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 1944399, Read name HWUSI-EAS715_100113:3:59:1626:1079#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 1944399, Read name HWUSI-EAS715_100113:3:59:1626:1079#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 2044255, Read name HWUSI-EAS715_100113:3:63:461:1816#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 2044255, Read name HWUSI-EAS715_100113:3:63:461:1816#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 2173246, Read name HWUSI-EAS715_100113:3:67:1075:709#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 2173246, Read name HWUSI-EAS715_100113:3:67:1075:709#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 2174105, Read name HWUSI-EAS715_100113:3:67:1125:1723#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 2174105, Read name HWUSI-EAS715_100113:3:67:1125:1723#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 2663210, Read name HWUSI-EAS715_100113:3:83:1248:281#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 2663210, Read name HWUSI-EAS715_100113:3:83:1248:281#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 3064036, Read name HWUSI-EAS715_100113:3:96:383:1101#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 3301642, Read name HWUSI-EAS715_100113:3:103:698:837#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 3301642, Read name HWUSI-EAS715_100113:3:103:698:837#0, CIGAR should have zero elements for unmapped read.
      ERROR: Record 3718533, Read name HWUSI-EAS715_100113:3:115:843:1180#0, MAPQ must should be 0 for unmapped read.
      ERROR: Record 3718533, Read name HWUSI-EAS715_100113:3:115:843:1180#0, CIGAR should have zero elements for unmapped read.
      [Tue Mar 09 11:36:26 EST 2010] net.sf.picard.sam.ValidateSamFile done.
      Runtime.totalMemory()=84475904


      Turns out that the first read from above maps off the end of the reference chromosome...

      Ref# CAGAGGCGGCGGCTCGGGGAGAAACCTCAGGCACGGCCGGGCCACCAGGAAAACACGGCCGCGGGATC <- end of chromosome
      Read CGGGGGCGGCGGCTCGGGGAGAAACCTCAGGCACGGCCGGGGCACCAGGAAAACACGGCCGCGGGATCCCA

      So is this a bug in bwa?
      It's complicated (best Top Gun quote). See the samtools mailing lists (help and devel) regarding these two issues. Feel free to voice your concerns on those lists as the solution to the above is ongoing.

      Comment

      • drio
        Senior Member
        • Oct 2008
        • 323

        #4
        Indeed,




        Goose: [Extending his middle finger] You know, the finger!
        Charlie: Yes, I know the finger, Goose.
        Goose: Sorry. I hate when it does that.
        Charlie: [to Maverick] So you're the one.
        Maverick: Yes, ma'am.
        -drd

        Comment

        • mard
          Member
          • Jan 2010
          • 21

          #5
          Thanks for the info.

          So looks like, for the moment, that the solution is to ignore these warnings in Picard by adding either IGNORE={INVALID_MAPPING_QUALITY,INVALID_CIGAR} (for ValidateSamFile.jar) or VALIDATION_STRINGENCY=SILENT (for ViewSam.jar, SortSam.jar and MarkDuplicates.jar)

          Would that be correct?

          Comment

          • KevinLam
            Senior Member
            • Nov 2009
            • 204

            #6
            Yes it would seem so.
            I am afraid that it will cause viewing problems in IGV downstream though but I can't confirm it as well.
            http://kevin-gattaca.blogspot.com/

            Comment

            • Bruins
              Member
              • Feb 2010
              • 78

              #7
              Sorry for the bump, but I wonder what the consequences are when we start using VALIDATION_STRINGENCY=SILENT. We'd like Picard to ignore

              Code:
              ERROR: Record 29078883, Read name HWUSI-EAS536_0001:4:51:19663:20378#0, CIGAR should have zero elements for unmapped read.
              ERROR: Record 29183722, Read name HWUSI-EAS536_0001:4:14:8317:13044#0, MAPQ should be 0 for unmapped read.
              ERROR: Record 29183722, Read name HWUSI-EAS536_0001:4:14:8317:13044#0, CIGAR should have zero elements for unmapped read.
              which, in the dataset we're currently analysing, are the only 3 errors.

              But... won't VALIDATION_STRINGENCY=SILENT ignore other, more serious issues as well (in the next dataset)?

              Also, when we have Picard ignore these errors, what about later steps? We are currently using FixMates (even on single end data) to get rid of the error.

              For the record, we too are using GATK with BWA.

              Originally posted by KevinLam
              I am afraid that it will cause viewing problems in IGV downstream though but I can't confirm it as well.
              Did anyone confirm this?
              Last edited by Bruins; 11-23-2010, 05:49 AM.

              Comment

              • drio
                Senior Member
                • Oct 2008
                • 323

                #8
                I would suggest not using SILENT at all. If you have to, be more specific on the error you want to ignore. The validation is very granular.
                -drd

                Comment

                • Bruins
                  Member
                  • Feb 2010
                  • 78

                  #9
                  Originally posted by drio View Post
                  I would suggest not using SILENT at all. If you have to, [...]
                  Well... the problem is that after reading this thread and some googling, I get the feeling that SILENT (or IGNORE=) is the only solution, other than running FixMates.

                  That takes me back to my question one: what would be the consequence of using SILENT? Drio would you like to comment on that some more?

                  I'm planning to run some tests, I'll report back later.

                  Comment

                  • drio
                    Senior Member
                    • Oct 2008
                    • 323

                    #10
                    You can setup VALIDATION_STRINGENCY=LENIENT, that will tell picard to show any error it sees but to continue with the processing. After that, you can inspect the validation output and decide to bail out or continue the execution of you your pipeline.
                    -drd

                    Comment

                    • petriedish
                      Junior Member
                      • Nov 2010
                      • 3

                      #11
                      I know its way later but...

                      I noticed recently that Picard has CleanSam.jar whose only purpose at this point is to clip mappings that extend beyond the reference. That may be helpful in removing these errors.
                      Last edited by petriedish; 12-14-2011, 11:39 AM. Reason: Typo

                      Comment

                      • odoyle81
                        Member
                        • Aug 2011
                        • 31

                        #12
                        CleanSam didn't seem to work - It just ignored the same reads but didn't remove them. At least for me..
                        Setting to lenient validation seemed to work though!

                        Comment

                        • oliviera
                          Member
                          • Apr 2010
                          • 31

                          #13
                          I am getting the same problem by using:
                          MarkDuplicates.jar
                          Using LENIENT also goes through.

                          Did someone look at the original question: is it a bug in bwa?
                          I try to repeat the pipeline published by Bowen et al 2012 in Genetics and they do not mention this problem with picard.

                          Comment

                          • mxr1895
                            Junior Member
                            • Feb 2012
                            • 6

                            #14
                            Bowtie generated alignments do not have this issue.

                            Comment

                            • Naarkhoo
                              Member
                              • Jan 2013
                              • 11

                              #15
                              What could be the conclusion of this post ? I am facing the same problem.

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-13-2026, 10:26 AM
                              0 responses
                              24 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              33 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              20 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              34 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...