Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • arkilis
    Senior Member
    • Jul 2013
    • 119

    #1

    Any suggestion on how to get to know the seq data is from which platform?

    Got some data from other lab people. They are not sure what platform it is. So I used the fastqc which can have a check on the read length and some tips on what platform it is. i.e. Quality scores across all bases (Sanger/ illumina 1.9 encoding). I would reckon it is probably from sanger.

    Any other thoughts?

    Thanks,
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.

    Comment

    • arkilis
      Senior Member
      • Jul 2013
      • 119

      #3
      Originally posted by Brian Bushnell View Post
      Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.
      Thanks for answering.

      One example line here is :

      @M00474:102:000000000-A9000:1:1101:19225:1361 1:N:0:1
      TGCTCACCTCGCCGCTGCACTGTGAAGCTCTCACCAACCCCGTAGTTGTTTCTGCACACGGTGTCCACCTGGCCCCGCCTGTCCTCCAGGATGTCCTTCTGGCTGTTCCAGGACTCGGCGACAGGCCGCCCTAGCTCCGTCACCGCCCGGTACTCCCCCCCGTCGCTGTCGAAGCGCACGAACTCCTCCTGGTTATAGAAGAGTCTTTCCAGGAACTGCACCCGCTCCGTCCCGTTGAAGAAATGACACTT
      +
      CACCCGGGGGBFGCGGGGFGGFGGDEGGFGGGGGGECFGGGGGDCFGFF,CFGGGGGGGD@FCGGGFGGGC,EFGGGGGG@FGGGGGFFFFGGFGGGGGG9<FGCFGGGGGFGFGGECFFDFB:BFGEFGGGDCFFGG@EGGGGGGGGG7E@EFGFGGG*CEEG:CEEGGGF5EDDGDEEGDGGGFFFGGFCFFFFF6D*)9CFGFFGFGG9:?(8?FF7?FB>>9>BB??FFFBFF()6<2:AABA7?B9

      Any idea? Thanks again!

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.

        Comment

        • arkilis
          Senior Member
          • Jul 2013
          • 119

          #5
          Originally posted by Brian Bushnell View Post
          Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.
          You are right. Mr. Genius! Just get confirmed with client. MiSeq.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 07:41 AM
          0 responses
          12 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-03-2026, 10:13 AM
          0 responses
          27 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          39 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          25 views
          0 reactions
          Last Post SEQadmin2  
          Working...