Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • arkilis
    Senior Member
    • Jul 2013
    • 119

    Any suggestion on how to get to know the seq data is from which platform?

    Got some data from other lab people. They are not sure what platform it is. So I used the fastqc which can have a check on the read length and some tips on what platform it is. i.e. Quality scores across all bases (Sanger/ illumina 1.9 encoding). I would reckon it is probably from sanger.

    Any other thoughts?

    Thanks,
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.

    Comment

    • arkilis
      Senior Member
      • Jul 2013
      • 119

      #3
      Originally posted by Brian Bushnell View Post
      Posting read headers may help; someone may recognized them. Also, a read length histogram (or range) might help narrow it down.
      Thanks for answering.

      One example line here is :

      @M00474:102:000000000-A9000:1:1101:19225:1361 1:N:0:1
      TGCTCACCTCGCCGCTGCACTGTGAAGCTCTCACCAACCCCGTAGTTGTTTCTGCACACGGTGTCCACCTGGCCCCGCCTGTCCTCCAGGATGTCCTTCTGGCTGTTCCAGGACTCGGCGACAGGCCGCCCTAGCTCCGTCACCGCCCGGTACTCCCCCCCGTCGCTGTCGAAGCGCACGAACTCCTCCTGGTTATAGAAGAGTCTTTCCAGGAACTGCACCCGCTCCGTCCCGTTGAAGAAATGACACTT
      +
      CACCCGGGGGBFGCGGGGFGGFGGDEGGFGGGGGGECFGGGGGDCFGFF,CFGGGGGGGD@FCGGGFGGGC,EFGGGGGG@FGGGGGFFFFGGFGGGGGG9<FGCFGGGGGFGFGGECFFDFB:BFGEFGGGDCFFGG@EGGGGGGGGG7E@EFGFGGG*CEEG:CEEGGGF5EDDGDEEGDGGGFFFGGFCFFFFF6D*)9CFGFFGFGG9:?(8?FF7?FB>>9>BB??FFFBFF()6<2:AABA7?B9

      Any idea? Thanks again!

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.

        Comment

        • arkilis
          Senior Member
          • Jul 2013
          • 119

          #5
          Originally posted by Brian Bushnell View Post
          Given that it's 251bp long, and the name look like the MiSeq convention, I would say that it's an Illumina MiSeq read.
          You are right. Mr. Genius! Just get confirmed with client. MiSeq.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM
          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Today, 10:26 AM
          0 responses
          9 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-09-2026, 10:04 AM
          0 responses
          24 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-08-2026, 10:08 AM
          0 responses
          16 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-07-2026, 11:05 AM
          0 responses
          33 views
          0 reactions
          Last Post SEQadmin2  
          Working...