[nucacidhunter]

If it is correct, I'd like to know how the p5 and p7 tethered stands were cut?

If you are looking for chemistry used for cleavage of strands during sequencing, I have got following from a rather old paper:

Immobilised oligos on paired end Flowcell surface:

Oligo ‘C’: 5’-PS-TTTTTTTTTTAATGATACGGCGACCACCGAGAUCTACAC-3’
(U = 2-deoxyuridine), Linearization of oligo C with “USER” enzyme retains strand 1, attached to “D” oligo.

Oligo ‘D’: 5’-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGAGoxoAT-3’,
(Goxo = 8-oxoguanine) Second strand is cleaved at the 8-oxoguanine in oligo 'D' using Fpg enzyme.

[cli]

GenoMax, thanks for the information. Nucacidhunter, thank for explaining the chemistry. This is really cool! Now feel more comfortable to try customized sequencing primers. Since each time there is only one strand interrogated for sequencing, even my sequencing primer could anneal to both strand, it should not cause any problems.

I still have some questions about the turn-around business though. After the i7 indexing read, the other strand would be synthesized along with i5 index sequenced after 7 dark cycles. Should the full length of the new strand be fully extended before the read 2 sequencing started, because the full strand is needed as sequencing template for read2? If so, where are the consumable (dNTPs etc.) come from? Are those also contained in the reagent cartridge? It shouldn't be part of the reagents for 200bp reads, should it? I feel I might sound silly, but those questions keep annoying me if I can't find an answer.

[nucacidhunter]

I still have some questions about the turn-around business though. After the i7 indexing read, the other strand would be synthesized along with i5 index sequenced after 7 dark cycles. Should the full length of the new strand be fully extended before the read 2 sequencing started, because the full strand is needed as sequencing template for read2? If so, where are the consumable (dNTPs etc.) come from? Are those also contained in the reagent cartridge? It shouldn't be part of the reagents for 200bp reads, should it? I feel I might sound silly, but those questions keep annoying me if I can't find an answer.

After last cycle of 2nd index read, it is stripped away and new strand synthesis starts and reagents for it are in the sequencing kit components. If you want to make sure that your sequencing will be successful, you need to provide more information about your experiment design and protocol and ....

I wonder how you ended up having the same priming site in both strands.

[DNA_Dan]

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.

Regarding this comment from a while back - if your target is a PCR amplicon product and the ends are all the same primer sequences, isn't the ONLY way to successfully sequence this is through a custom sequencing primer?

Otherwise you'd be sequencing a pool of homogeneous ends for the length of your PCR primers, right? (Unless your pool is made of products that came from multiple primer sets.)

[monia]

indexed primer

hi everybody, i will apply the Miseq staregy but i didn't understand how to prepare the indexed primer from my initial primer?!!

[cli]

I just did my duel index sequencing on miseq. It returned nice results. Here is the index primer (primer for indexing PCR) I used:

P7 Index CAAGCAGAAGACGGCATACGAGATgctaacgcGTGACTGGAGTTCAGACGTGT
P5 Index AATGATACGGCGACCACCGAGATCTACACgctaacgcACACTCTTTCCCTACACGACGCTCTT

Here is the sample sheet I used for the run:

[Header]
IEMFileVersion 4
Date 12/10/14
Workflow GenerateFASTQ
Application FASTQ Only
Assay TruSeq HT
Description
Chemistry Amplicon

[Reads]
251
251

[Settings]
ReverseComplement 0
Adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

[Data]
Sample_ID Sample_Name Sample_Plate Sample_Well I7_Index_ID index I5_Index_ID index2 Sample_Project Description
1 A11 Index517 GCGTTAGC IS4_517 GCTAACGC

…

Hope this helps