Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • nucacidhunter
    Jafar Jabbari
    • Jan 2013
    • 1250

    #46
    If it is correct, I'd like to know how the p5 and p7 tethered stands were cut?
    If you are looking for chemistry used for cleavage of strands during sequencing, I have got following from a rather old paper:

    Immobilised oligos on paired end Flowcell surface:

    Oligo ‘C’: 5’-PS-TTTTTTTTTTAATGATACGGCGACCACCGAGAUCTACAC-3’
    (U = 2-deoxyuridine), Linearization of oligo C with “USER” enzyme retains strand 1, attached to “D” oligo.

    Oligo ‘D’: 5’-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGAGoxoAT-3’,
    (Goxo = 8-oxoguanine) Second strand is cleaved at the 8-oxoguanine in oligo 'D' using Fpg enzyme.

    Comment

    • cli
      Member
      • Mar 2011
      • 29

      #47
      GenoMax, thanks for the information. Nucacidhunter, thank for explaining the chemistry. This is really cool! Now feel more comfortable to try customized sequencing primers. Since each time there is only one strand interrogated for sequencing, even my sequencing primer could anneal to both strand, it should not cause any problems.

      I still have some questions about the turn-around business though. After the i7 indexing read, the other strand would be synthesized along with i5 index sequenced after 7 dark cycles. Should the full length of the new strand be fully extended before the read 2 sequencing started, because the full strand is needed as sequencing template for read2? If so, where are the consumable (dNTPs etc.) come from? Are those also contained in the reagent cartridge? It shouldn't be part of the reagents for 200bp reads, should it? I feel I might sound silly, but those questions keep annoying me if I can't find an answer.

      Comment

      • nucacidhunter
        Jafar Jabbari
        • Jan 2013
        • 1250

        #48
        Originally posted by cli View Post
        I still have some questions about the turn-around business though. After the i7 indexing read, the other strand would be synthesized along with i5 index sequenced after 7 dark cycles. Should the full length of the new strand be fully extended before the read 2 sequencing started, because the full strand is needed as sequencing template for read2? If so, where are the consumable (dNTPs etc.) come from? Are those also contained in the reagent cartridge? It shouldn't be part of the reagents for 200bp reads, should it? I feel I might sound silly, but those questions keep annoying me if I can't find an answer.
        After last cycle of 2nd index read, it is stripped away and new strand synthesis starts and reagents for it are in the sequencing kit components. If you want to make sure that your sequencing will be successful, you need to provide more information about your experiment design and protocol and ....

        I wonder how you ended up having the same priming site in both strands.

        Comment

        • DNA_Dan
          Member
          • Nov 2008
          • 21

          #49
          Originally posted by TonyBrooks View Post
          However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.
          Regarding this comment from a while back - if your target is a PCR amplicon product and the ends are all the same primer sequences, isn't the ONLY way to successfully sequence this is through a custom sequencing primer?

          Otherwise you'd be sequencing a pool of homogeneous ends for the length of your PCR primers, right? (Unless your pool is made of products that came from multiple primer sets.)

          Comment

          • monia
            Junior Member
            • Dec 2014
            • 4

            #50
            indexed primer

            hi everybody, i will apply the Miseq staregy but i didn't understand how to prepare the indexed primer from my initial primer?!!

            Comment

            • cli
              Member
              • Mar 2011
              • 29

              #51
              I just did my duel index sequencing on miseq. It returned nice results. Here is the index primer (primer for indexing PCR) I used:

              P7 Index CAAGCAGAAGACGGCATACGAGATgctaacgcGTGACTGGAGTTCAGACGTGT
              P5 Index AATGATACGGCGACCACCGAGATCTACACgctaacgcACACTCTTTCCCTACACGACGCTCTT

              Here is the sample sheet I used for the run:

              [Header]
              IEMFileVersion 4
              Date 12/10/14
              Workflow GenerateFASTQ
              Application FASTQ Only
              Assay TruSeq HT
              Description
              Chemistry Amplicon

              [Reads]
              251
              251

              [Settings]
              ReverseComplement 0
              Adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
              AdapterRead2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

              [Data]
              Sample_ID Sample_Name Sample_Plate Sample_Well I7_Index_ID index I5_Index_ID index2 Sample_Project Description
              1 A11 Index517 GCGTTAGC IS4_517 GCTAACGC



              Hope this helps

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                by SEQadmin2



                CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                Despite this, “CRISPR helped turn genome editing from a specialized technique into
                ...
                07-31-2026, 11:01 AM
              • SEQadmin2
                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                by SEQadmin2


                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                The systematic characterization of the human proteome has
                ...
                07-20-2026, 11:48 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 08-06-2026, 07:41 AM
              0 responses
              19 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 08-03-2026, 10:13 AM
              0 responses
              33 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-31-2026, 02:55 AM
              0 responses
              43 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-24-2026, 12:17 PM
              0 responses
              26 views
              0 reactions
              Last Post SEQadmin2  
              Working...