Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • cur
    Junior Member
    • Dec 2009
    • 5

    #46
    solexa adapter sequences for paired end data

    Hi
    I wonder if somebody can help me here....I have got some solexa data (paired end reads) and want to map these to the genome with bwa/maq...However when I did this only 20% of sequences mapped so I gather I want to check/ for presence of adapters in the sequences and then repeat the alignment after trimming of the data.

    Which adapter sequences should I screen for- as this is paired end data I assume its the 5` to 3` sequence for the PE adpter 1 and 2 which I found in one of your posts?
    Paired-end DNA

    PE Adapter1:
    5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
    3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
    PE Adapter2:
    5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
    3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

    In fasta format:
    >Solexa-PairedEndAdapter1
    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    >SolexaPairedEndAdapter2
    GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

    If I had single end solexa data would I then screen for the same adapters

    Genomic DNA oligonucleotide sequences (from previous posting)
    Adapters 1
    5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
    5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    Last edited by cur; 03-24-2010, 03:39 AM.

    Comment

    • greigite
      Senior Member
      • Mar 2009
      • 145

      #47
      Hi cur,

      That is not quite right- you have to use the sequence of the PCR product produced by amplification of your library with paired end primers to identify sequences to screen out. You are looking for sequence between your insert and the flow cell oligo. This would appear in your product only if your insert was incredibly short (or nonexistent)- I suspect you may have sequenced a whole bunch of adapters. What did your Bioanalyzer trace look like? I've found that the molar ratio of amplified adapter sequence (~130 bp) to amplified library is pretty close to the percentage of adapter only reads you get.

      I believe the following is right but others please correct if not:

      Sequence between your insert and the flow cell oligo for Round 1 paired end:
      AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG

      Sequence between your insert and the flow cell oligo for Round 2 paired end:
      AGAAAGGGATGTGCTGCGAGAAGGCTAGA

      For single read the appropriate sequence to screen out depends whether you prepped your libraries with single or paired end adapters.

      Comment

      • jsilhavy
        Junior Member
        • Apr 2010
        • 1

        #48
        Illumina Index PE adaptor

        Hi,

        I purchased Illumina's multiplexing kit and ligated the index PE adaptor to my samples. However, I soon learned that this kit is not compatible with Agilent's SureSelect DNA Capture protocol (microarray based). I would still like to proceed with the library prep (have not added the barcodes/indexes) but was wondering if anyone knew the difference between Illumina's Index PE adaptor and standard PE adaptors.

        Thanks!!

        Comment

        • clpX
          Junior Member
          • Apr 2010
          • 2

          #49
          Re: Illumina Index PE adaptor

          Hi jsilhavy,

          the adapters are quite similar because the index is added in the PCR step and does not come with the adapters. I attach a file with the sequences that I found in some other post in this forum.
          Attached Files

          Comment

          • cur
            Junior Member
            • Dec 2009
            • 5

            #50
            Hi greigite
            Thanks for the reply- in this case the answer was actually simple in the end- the sequencing service had not sent us the right data. Once we got the right data there was no problem with the alignment :-) what a relief

            Comment

            • AdamB
              Member
              • Apr 2010
              • 43

              #51
              Does anyone know the primer concentrations required for SE ChIP library preparation?

              This is the information given in the protocol:
              Prepare the following PCR reaction mix:
              • DNA (36 μl)
              • 5x Phusion* buffer (10 μl)
              • dNTP mix (1.5 μl)
              • PCR primer 1.1 (1 μl)
              • PCR primer 2.1 (1 μl)
              • Phusion* polymerase (0.5 μl)
              The total volume should be 50 μl.
              N.b. only 10 ng of DNA is used for the library preparation in the first place, so the primer concentrations might be lower than for whole genome DNA sequencing?

              Thanks.
              Last edited by AdamB; 04-23-2010, 07:31 AM.

              Comment

              • AdamB
                Member
                • Apr 2010
                • 43

                #52
                I found the answer in another thread. Just to check, I called Illumina tech support, and they have confirmed the stock PCR primer 1.1 and 2.1 concentration is 25 uM.

                Comment

                • jchoo
                  Junior Member
                  • Mar 2010
                  • 9

                  #53
                  thanks,thats what i want,by the way weather all the illumina use the same adapter?

                  Comment

                  • kr067
                    Junior Member
                    • May 2010
                    • 5

                    #54
                    paired end seq

                    Hi all,
                    Im new to paired end mRNA seq. Are the adapters for the paired end seq same as the genomic DNA adapters?
                    Thanks

                    Comment

                    • sci_guy
                      Member
                      • Jan 2008
                      • 83

                      #55
                      @kr067: No. Read the pdf posted by clpX above.

                      Comment

                      • kr067
                        Junior Member
                        • May 2010
                        • 5

                        #56
                        Thank you sci_guy! that was really helpful!

                        Comment

                        • amango
                          Member
                          • Dec 2009
                          • 17

                          #57
                          I noticed that several people were wondering about adaptor and primer concentrations in the Illumina kit. I just spoke to an Illumina tech support person, and for RNA-seq at least, the working concentration for the adaptor oligo mix is 15 uM while PCR primers are 25 uM.

                          Comment

                          • mx1970
                            Junior Member
                            • Sep 2009
                            • 3

                            #58
                            Hi,
                            I want to do directional mRNA seq. I have to use the Small RNA Sequencing Primer during the primer hybridization.
                            Does anybody know at which concentration should I adjust this primer?
                            thanks

                            Comment

                            • AdamB
                              Member
                              • Apr 2010
                              • 43

                              #59
                              I ordered the following primers from Sigma:

                              AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

                              CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T

                              (HPLC-purified)
                              *=Phosphorothioate bond

                              However I can't get them working with my ChIP input DNA sample. Have tried varying the number of cycles, but each time after the PCR amplification of my library I only have 2 or 3 ng/ul, whereas colleagues have had more like 20 ng/ul.

                              I'm unsure whether the problem is with the primers or something else. As far as I know, everything apart from the primers is the same as colleagues' libraries that worked. I don't have any Illumina primer to test alongside.

                              Comment

                              • matthew.mccabe@teagasc.ie
                                Junior Member
                                • May 2010
                                • 1

                                #60
                                PE indexed libraries

                                I'm trying to figure out what the final sequence of an Illumina PE indexed library is and where the enrichment primers and sequencing primers go. Has anyone figured out a schematic of generation of the PE indexed libraries showing all the sequence similar to the one I found on this forum for non-indexed PE libraries (see below).

                                dandestroy09-18-2008, 07:13 PM
                                Sorry for the small font, but that's the only way I could make it fit




                                PE Adapter1:
                                5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
                                3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
                                PE Adapter2:
                                5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
                                3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
                                PE PCR Primer1:
                                5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
                                3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
                                PE PCR Primer2:
                                5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
                                3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
                                Result Library:
                                5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
                                3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
                                PE DNA Sequencing Primer1
                                5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
                                3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
                                PE DNA Sequencing Primer2
                                5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
                                3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'

                                Comment

                                Latest Articles

                                Collapse

                                • mylaser
                                  Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by mylaser
                                  Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                                  If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                                  This guide explains everything you need to know about...
                                  Today, 01:13 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-09-2026, 10:04 AM
                                0 responses
                                17 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-08-2026, 10:08 AM
                                0 responses
                                10 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-07-2026, 11:05 AM
                                0 responses
                                22 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-02-2026, 11:08 AM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...