Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • yao_licr
    Junior Member
    • Jul 2014
    • 7

    substitution using sed or awk

    Hi all,
    I just start to use sed and awk. I would like to change the following fastq file

    @SRR391606.9.1 1 length=50
    AGCACCGCGAGGGCGGAGCTGCGTTCTCCTCTGCACAGCTTTCGGTGGTA
    +SRR391606.9.1 1 length=50
    @9@?<<AA:3>7A/;@?B57@6;++4=4<,=6=+++17/)1?%%%%%%%%
    @SRR391606.10.1 2 length=50
    GTTGCGTTCTCCTCAGCACAGACCCGGAGAGCACCGCGAGGGCGGAGCTG
    +SRR391606.10.1 2 length=50
    ?BB?BA?AABAB>->ABB=99<AAB++35)137<>:37=<735(2-9492

    into following fastq file:

    @SRR391606.9 1 length=50
    AGCACCGCGAGGGCGGAGCTGCGTTCTCCTCTGCACAGCTTTCGGTGGTA
    +SRR391606.9 1 length=50
    @9@?<<AA:3>7A/;@?B57@6;++4=4<,=6=+++17/)1?%%%%%%%%
    @SRR391606.10 2 length=50
    GTTGCGTTCTCCTCAGCACAGACCCGGAGAGCACCGCGAGGGCGGAGCTG
    +SRR391606.10 2 length=50
    ?BB?BA?AABAB>->ABB=99<AAB++35)137<>:37=<735(2-9492

    Basically, it is a task to remove the ".1" on every other line. As I have a huge fastq file around 30 Gb, I only put the 9th and 10th reads out of it.

    Does anyone know how to do it using sed or awk? Please also explain the script in detail as I am a beginner.

    Thanks a lot!

    Yao
  • dschika
    Member
    • Mar 2010
    • 56

    #2
    This command should do the job:

    Code:
    awk '{if ($1 ~ /SRR/) {split($0, T, ".1 "); print T[1], T[2]}  else print $0}' YOURINPUT.fastq
    Since you mentioned sed and awk I assume you know that $1 = first field, $2 = second field (fields separated by whitespaces if not defined otherwise by FS) and $0 = whole line.

    The command checks if in the first field SRR is present ("if ($1 ~ /SRR/)"). If yes, it splits the content of the first line by ".1 " and stores the result in T. In this case ".1 " can be found only once in each line with SRR. Therefore, printing of T[0] and T[1] results in the line without ".1 ".

    If the line does not contain SRR (i.e., we are at a line with sequence or quality values) print the whole line.

    Comment

    • yao_licr
      Junior Member
      • Jul 2014
      • 7

      #3
      Thanks for the detailed explanation. It works well.

      Comment

      • dschika
        Member
        • Mar 2010
        • 56

        #4
        No problem, I just realized, that I was thinking way to complicated:

        sed 's/\.1 / /g' YOURINPUT.fastq > out.fastq

        Just replace ".1 " with " " and escape the "." with a backslash.

        Comment

        • yao_licr
          Junior Member
          • Jul 2014
          • 7

          #5
          Sorry, ".1" is the pattern to be replace by " ", so why do you put an empty space after 1? I mean the empty space in "/\.1 /" .

          Thanks!

          Comment

          • yao_licr
            Junior Member
            • Jul 2014
            • 7

            #6
            I got it now, as I have .1.1 in the first read; if there is no empty space after "\.1", both of them will be replaced. In your script, ".1 " is the pattern but not ".1" .

            Thanks!

            Comment

            • dschika
              Member
              • Mar 2010
              • 56

              #7
              Correct, you're welcome!

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM
              • SEQadmin2
                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                by SEQadmin2



                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                07-08-2026, 05:17 AM
              • GATTACAT
                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by GATTACAT
                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                07-01-2026, 11:43 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-13-2026, 10:26 AM
              0 responses
              26 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-09-2026, 10:04 AM
              0 responses
              35 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-08-2026, 10:08 AM
              0 responses
              22 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-07-2026, 11:05 AM
              0 responses
              34 views
              0 reactions
              Last Post SEQadmin2  
              Working...