Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Thias
    Member
    • Mar 2013
    • 45

    Some questions regarding blacklisting

    Hello Brian,

    Sorry for bothering you again, but I have a question regarding blacklisting and its (correct) usage.

    As a favor for a collegue, I quickly mapped some genomic PE data (ChIP-seq) to the human genome. The mapping statistics looked good and I handed the data over to him didn't give it a moment's thought anymore.

    However he assessed the coverage profiles and now suspects a contamination of his library with DNA fragments originating from certain BACs, which are used in his laboratory. He showed me some example chromosomal regions and indeed, there are are several ~150kb big regions with remarkable increase in coverage overlapping the annotated BAC.

    I offered to exclude reads from those BAC areas of the genome and try to identify real ChIP-signal somewhere else in the data.

    Thus I restarted the alignment from FASTQ and specified a Multi-FASTA file containing the genomic sequences of the BACs as blacklist. bbmap indeed now generated the specified outb sam file, but not a single read pair went there - for every sample the file was always empty except the header.

    Code:
    Genome:                 3
    Key Length:             13
    Max Indel:              16000
    Minimum Score Ratio:    0.56
    Mapping Mode:           normal
    Reads Used:             148059914       (14335498222 bases)
    
    Mapping:                51822.670 seconds.
    Reads/sec:              1428.52
    kBases/sec:             276.63
    
    
    Pairing data:           pct reads       num reads       pct bases          num bases
    
    mated pairs:             98.5211%        72935102        98.8062%        14164366056
    bad pairs:                1.3022%          964043         1.2593%          180529886
    insert size avg:          425.12
    
    
    Read 1 data:            pct reads       num reads       pct bases          num bases
    
    mapped:                  99.8531%        73921244        99.8812%         7174307831
    unambiguous:             92.3162%        68341677        92.4104%         6637694291
    ambiguous:                7.5369%         5579567         7.4708%          536613540
    low-Q discards:           0.0000%               0         0.0000%                  0
    
    perfect best site:       78.4885%        58104980        78.7959%         5659785119
    semiperfect site:        78.5457%        58147328        78.8410%         5663027631
    rescued:                  0.2712%          200743
    
    Match Rate:                   NA               NA        97.9450%         7152758588
    Error Rate:              21.3317%        15768653         2.0538%          149983878
    Sub Rate:                19.9830%        14771656         0.2769%           20218648
    Del Rate:                 1.1258%          832171         1.7599%          128524996
    Ins Rate:                 0.8954%          661856         0.0170%            1240234
    N Rate:                   0.0807%           59648         0.0012%              90361
    
    
    Read 2 data:            pct reads       num reads       pct bases          num bases
    
    mapped:                  99.8967%        73953500        99.9086%         7146116046
    unambiguous:             92.1534%        68221148        92.2105%         6595499668
    ambiguous:                7.7433%         5732352         7.6981%          550616378
    low-Q discards:           0.0000%              13         0.0000%                470
    
    perfect best site:       68.2412%        50518933        68.6293%         4908820958
    semiperfect site:        68.3924%        50630855        68.7725%         4919060978
    rescued:                  0.3138%          232341
    
    Match Rate:                   NA               NA        96.7175%         7114752246
    Error Rate:              20.8947%        15452343         3.1485%          231610349
    Sub Rate:                19.4650%        14395026         0.2754%           20259503
    Del Rate:                 1.4361%         1062021         2.8562%          210107455
    Ins Rate:                 0.8087%          598072         0.0169%            1243391
    N Rate:                  13.1625%         9734162         0.1340%            9860906
    
    Total time:             53846.780 seconds
    To cross-validate, I indexed the same Multi-FASTA file and used bbmap to align the reads with exactly the same parameter settings against it. This are the results from mapping the same sample as above against the BAC collection:

    Code:
    Genome:                 1
    Key Length:             11
    Max Indel:              16000
    Minimum Score Ratio:    0.56
    Mapping Mode:           normal
    Reads Used:             148059914       (14335498222 bases)
    
    Mapping:                17929.866 seconds.
    Reads/sec:              4128.86
    kBases/sec:             799.53
    
    
    Pairing data:           pct reads       num reads       pct bases          num bases
    
    mated pairs:              0.2606%          192935         0.2584%           37041616
    bad pairs:                0.2608%          193052         0.2578%           36960674
    insert size avg:          1540.38
    
    
    Read 1 data:            pct reads       num reads       pct bases          num bases
    
    mapped:                   2.9434%         2179014         2.8388%          203905833
    unambiguous:              1.6845%         1247069         1.6340%          117369776
    ambiguous:                1.2589%          931945         1.2048%           86536057
    low-Q discards:           0.0000%               0         0.0000%                  0
    
    perfect best site:        0.0508%           37607         0.0407%            2926546
    semiperfect site:         0.0514%           38023         0.0409%            2939958
    rescued:                  0.0097%            7213
    
    Match Rate:                   NA               NA         6.7979%          181724888
    Error Rate:              98.2727%         2141375        93.2020%         2491518976
    Sub Rate:                98.2038%         2139875         0.7663%           20485726
    Del Rate:                28.9776%          631426        92.3724%         2469340316
    Ins Rate:                20.6261%          449445         0.0633%            1692934
    N Rate:                   0.0796%            1735         0.0001%               2285
    
    
    Read 2 data:            pct reads       num reads       pct bases          num bases
    
    mapped:                   4.8730%         3607461         4.6617%          333437379
    unambiguous:              2.7381%         2026992         2.6422%          188984411
    ambiguous:                2.1349%         1580469         2.0196%          144452968
    :
    My questions now are:
    • Shouldn't I have just by random some pairs going to the outb sam file ? (since this are BACs which contain fragments of the human genome, against which I align)
    • Does the latter mapping results point into the direction of a BAC contamination at all? I am a bit puzzling, because of the low number of mated pairs.

    Comment

    • Brian Bushnell
      Super Moderator
      • Jan 2014
      • 2709

      I just verified that "outb" and "blacklist" still work, but their usage may be a bit unclear. I don't use them anymore as they have been superseded by BBSplit which allows any number of reference-specific output streams. I think in your case you may not have built the BAC fasta into the index.

      How to use the blacklist to remove e.coli contaminants from human reads:

      Concatenate the references:
      cat ecoli.fa human.fa > both.fa

      index the concatenated file:
      bbmap.sh ref=both.fa

      map to the combined index and specify a blacklist:
      bbmap.sh in=reads.fq outm=good.fq outb=bad.fq blacklist=ecoli.fa

      The "blacklist" flag does not index anything; it only parses the headers in the fasta file, whose contents must have already been indexed. If a read can map to two places equally well, by default, BBMap will assign it to the first genomic location (unless you alter the "ambig" flag). That is why the blacklisted files must be first when concatenating files together.

      The way you would do this with BBSplit is simpler:

      bbsplit.sh ref=ecoli.fa,human.fa
      bbsplit.sh in=reads.fq pattern=out_%.fq


      That would create two output files, out_ecoli.fq and out_human.fq (or .sam if you want). You can determine the behavior of reads that map to both references equally well in bbsplit with the "ambiguous2" flag; default behavior is to go to the output stream for the first reference. The other options are "ambig2=toss" (discard anything that maps to multiple references equally well), "ambig2=all" (output it to the stream for each reference it maps to equally well), and "ambig2=split" (write the multi-mapping reads to separate files).

      Comment

      • Thias
        Member
        • Mar 2013
        • 45

        Originally posted by Brian Bushnell View Post
        I think in your case you may not have built the BAC fasta into the index.
        *Sigh*. You know your cardboard homies ("Pappenheimer" ) too well ...

        I was indeed not rebuilding the index of the reference genome for that purpose, but just added the blacklist parameter.

        Thanks a lot for the fast response, the detailed description of the procedure and the inherent logic.

        Originally posted by Brian Bushnell View Post
        The way you would do this with BBSplit is simpler:

        bbsplit.sh ref=ecoli.fa,human.fa
        bbsplit.sh in=reads.fq pattern=out_%.fq
        Great! This possibility will also aid to solve another question in a different context. Thanks for pointing this out ...

        Comment

        • Brian Bushnell
          Super Moderator
          • Jan 2014
          • 2709

          Originally posted by Thias View Post
          *Sigh*. You know your cardboard homies ("Pappenheimer" ) too well ...
          That was an interesting reference; I enjoyed reading it! In fact, it spurred me to go see if Mount&Blade II was near completion, but alas, it still seems to be in permanent development.

          Since I develop BBMap at a facility where people use it in unexpected ways, I'm used to getting error reports caused by both bugs and misunderstandings. Both are valuable! I don't like difficult-to-use tools, but I can only make BBMap more user-friendly with feedback, so please don't feel shy to give feedback whether or not there's a bug.

          In other news - BBMap and Pileup now have an "rpkm" flag. This will directly report RPKM and FPKM counts (as well as coverage depth and raw count) for each reference sequence, in the same format as Seal. Essentially, it's for RNA-seq quantification, and I primarily made it to make it easier to compare BBMap with Seal (since the RPKM/FPKM output only makes sense with a transcriptome reference, not a genome reference) - but it's there if anyone wants it.

          Comment

          • rkanwar
            Junior Member
            • Feb 2011
            • 8

            Strange behavior for some of the aligned PE reads

            Hello Brian,

            I am using BBMap to align DNASeq PE data [100x2 bp reads]. The alignment works fine. But I am seeing strange alignments for a few pairs. For examples consider the SAM records for the following PE read:

            Code:
            R0266248:292:C5C0TACXX:4:1101:6482:13924 1:N:0:CTGAAGCTTAATCTTA	153	1	16877330	44	101M	=	16877330	0	GAAAGCCCCAGTGCCATCAGACAGCCACACCTCATCCTCATCAGTGACACTATGAGGTGAAGACCCCTCCAGGGTGTCAAGAGCTCTCAGCTTCCAGGGTC	4DDDBDDDDDDDDDDEDDDDBDDDDCAACFFFFHHHHHHIGIJIFJIHGIIIJJJJJJJJIHIIIJJIJJJJJJJIIJJJIJJJJJJJHHHHHFFFFFCCC	RG:Z:AS_N+AS_N_1+FCC5C0TACXX+L4+ICTGAAGCT-TAATCTTA	AM:i:0	NM:i:0
            Code:
            R0266248:292:C5C0TACXX:4:1101:6482:13924 1:N:0:CTGAAGCTTAATCTTA	101	1	16877330	0	*	=	16877330	0	TCCTCAGCCAGCTTCCCTTCTAGTCAATTTTTTGGGAGCTGGGCCTCCAGCTGGGATACTCTCTGGATGAGACTCTTCAGGTCCTTTTTGGCCTGAAGTCC	CCCFFFFFHHHHHJJJJJJJJJIJJJGJJJJJJIJJJJJJJJJJJJJJJJJJJJJGHJJHHHHHHFFFFFEEEEECDDDDDCDDDDDDC?@CCDDDDDDDD	RG:Z:AS_N+AS_N_1+FCC5C0TACXX+L4+ICTGAAGCT-TAATCTTA
            The first end aligns properly. The other end does not align and has an alignment score of 0, which I think means that there were multiple alignments for this end. When I BLAT these two sequences then this is what I get for the reads:

            Code:
            END1
            browser details YourSeq          101     1   101   101 100.0%     1   +   16877330  16877430    101
            browser details YourSeq           99     1   101   101  99.1%     1   -   17183501  17183601    101
            browser details YourSeq           97     1   101   101  98.1%     1   +   17008345  17008445    101
            browser details YourSeq           95     1   101   101  97.1%     1   +   21738088  21738188    101
            browser details YourSeq           91     1   101   101  95.1%     1   +  144879169 144879269    101
            Code:
            END2
            browser details YourSeq          101     1   101   101 100.0%     1   -   17183611  17183711    101
            browser details YourSeq          101     1   101   101 100.0%     1   +   16877220  16877320    101
            browser details YourSeq           93     1   101   101  96.1%     1   +  144879059 144879159    101
            browser details YourSeq           92     1   101   101  97.0%     1   +   21737977  21738078    102
            browser details YourSeq           74    26   101   101  98.7%     1   +   17008260  17008335     76
            browser details YourSeq           25     9    34   101 100.0%    10   +   69768146  69768175     30
            BBMap aligns the first end properly with a start position of 16877330. The other end has 2 perfect hits, one of those hits [16877220] is in the neighborhood of of the first end. This neighboring hit should have been reported as the alignment for this end as it best explained the whole fragment [my insert sizes are around 250bp]. Here is the command I am using. I want to get only those alignment where the PE reads aligns uniquely on the reference genome. Can you please help me to set the right flags to get these reads align properly ? Thanks!

            Code:
            bbmap_cmd="${bbmap} -Xms10G -Xmx31G \
                       path=${bbmap_ref} \
                       in=${bbduk_fq1} \
                       in2=${bbduk_fq2} \
                       out=stdout \
                       ambiguous=toss \
                       rgid=${ID} \
                       rgsm=${SM} \
                       rglb=${LIB} \
                       rgpl=${PL} \
                       pairlen=1000 \
                       threads=12 \
                       slow=t \
                       local=t \
                       reads=10000 \
                       samversion=1.3"
            regards,
            Rahul

            Comment

            • Brian Bushnell
              Super Moderator
              • Jan 2014
              • 2709

              Hi Rahul,

              In this case, the problem is "ambiguous=toss". If you omit that flag, the second read will be mapped. You can always filter ambiguous mappings later by excluding anything with a mapq of under 4.

              However, this situation is a bit strange. your BLAT alignments show both reads hitting the same strand. Did you reverse-complement it prior to BLAT, or something? By default, BBMap requires read 1 and read 2 to be on opposite strands, so if they really are both mapping to the same strand, they won't be considered a proper pair. You can override that with "rcs=f" (requirecorrectstrand=false), but in this case, it's not clear to me that they should be paired; rather, it seems like that might be a chimeric molecule or some kind of structural rearrangement in the genome. Or a misassembly.

              Comment

              • rkanwar
                Junior Member
                • Feb 2011
                • 8

                Hello Brian,

                Thank you for your reply! I was using the read sequence from the SAM record for BLAT, which might explain the same strand.
                Is there some easy way to filter out properly mapped PE reads [which have the right orientation and are within the fragment length distribution] which are uniquely aligned ?

                Rahul

                Comment

                • Brian Bushnell
                  Super Moderator
                  • Jan 2014
                  • 2709

                  You can filter proper pairs only with the "po" flag; unpaired reads will then be classified as unmapped. You can use the 'outm' stream to just get mapped reads. You can also filter with samtools after the fact.

                  From these, you could filter only the pairs where at least one read is uniquely aligned (mapq>3 or some higher threshold for greater confidence), but this can't be done in BBMap currently; you could, however, do this with a custom script or with samtools.

                  Comment

                  • rkanwar
                    Junior Member
                    • Feb 2011
                    • 8

                    Hello Brian,

                    I removed the flag "ambiguous=toss" as you had suggested. I was able to get the correct alignments for the previous PE read and many other. But there are still a few PE reads which are not aligning properly, even though I can find the correct alignment for them using BLAT. I used the following command for aligning the data:

                    Code:
                    bbmap_cmd="${bbmap} -Xms10G -Xmx31G \
                               path=${bbmap_ref} \
                               in=${bbduk_fq1} \
                               in2=${bbduk_fq2} \
                               out=stdout \
                               rgid=${ID} \
                               rgsm=${SM} \
                               rglb=${LIB} \
                               rgpl=${PL} \
                               pairlen=1000 \
                               threads=12 \
                               slow=t \
                               local=t \
                               maxsites2=2000 \
                               reads=10000 \
                               samversion=1.3"
                    One example of PE read that still behaves odd is the following. I can BLAT both the sequences and can see that there is a unique alignment which explains this read fragment. The % of such reads is very small [0.06%]. I am using grhc37 fasta file that comes with the GATK bundle as the reference. I am using v34.48 of BBMap.

                    Code:
                    R0266248:292:C5C0TACXX:4:1101:11723:6183 1:N:0:CTGAAGCTTAATCTTA	101	1	40799223	0	*	=	40799223	0	GAATTATAATCCCCATAATCTCCACCTGTCAAGGGTGGAACCAGATGTAGGTTATTTCCCTTGATGTCTACAATATCACCTTTCTTATAGATTCGCATATA	<<==<=<=>>==>=<===>>>===>=>=<=;>=>=<=>==>======<======>>=====>>=<==>>==<>====<====<>===<====<========	MC:Z:101M	BD:Z:MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMLMMMMMMMMMMMMMMMMMMMMMMMMMLMMMMMMMMMMMMMMMMMM	PG:Z:MarkDuplicates	RG:Z:AS_N+AS_N_1+FCC5C0TACXX+L4+ICTGAAGCT-TAATCTTA	BI:Z:OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO
                    R0266248:292:C5C0TACXX:4:1101:11723:6183 1:N:0:CTGAAGCTTAATCTTA	153	1	40799223	44	101M	=	40799223	0	TTTGTCATTTTGGCGAATTACTGGAAGGTGGCGTTTCTGGCCGTAAGGCTGATATTCTTCATTTTTAAACCCAATATAACCATCCTTTCCTGTAGACTCTT	========<<3===3===<333===<=====<====><==<========<======>>=>=>==><<=<=>>>==<=>=>=========><====<>====	BD:Z:LMMMMMMLLMMMMMMMMMMMMMMMMMMMMMMMMLMMMMMMMMMMMMMMMMMMMMMMMMMMMLLLMMLMMMMMMMMMMMMMMMMMMLMMMMMMMMMMMMMMM	PG:Z:MarkDuplicates	RG:Z:AS_N+AS_N_1+FCC5C0TACXX+L4+ICTGAAGCT-TAATCTTA	BI:Z:OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO	AM:i:0	NM:i:0
                    Rahul

                    Comment

                    • Brian Bushnell
                      Super Moderator
                      • Jan 2014
                      • 2709

                      BBMap is a global aligner. If you use the local flag, it will trim global alignments to become local alignments, but it will not find terrible global alignments in the first place. When run at high sensitivity, this is the output:

                      Code:
                      @PG	ID:BBMap	PN:BBMap	VN:34.59	CL:java -Djava.library.path=/usr/common/jgi/utilities/bbtools/prod-v34.59/lib -ea -Xmx31g align2.BBMapPacBio build=1 overwrite=true minratio=0.40 fastareadlen=6000 ambiguous=best minscaf=100 startpad=10000 stoppad=10000 midpad=6000 -Xmx31g t=1 k=11 in=pair3.fq out=pb.sam path=/global/projectb/sandbox/gaag/bbtools/hg191 reads=4 int=t ignorequality minratio=0.1 maxindel=40 vslow ambig=all customtag idtag ow reads=1
                      1 	99	chr1	40799086	4	3=3X2=3I4=40I46=	=	40799223	238	GAATTATAATCCCCATAATCTCCACCTGTCAAGGGTGGAACCAGATGTAGGTTATTTCCCTTGATGTCTACAATATCACCTTTCTTATAGATTCGCATATA	<<==<=<=>>==>=<===>>>===>=>=<=;>=>=<=>==>======<======>>=====>>=<==>>==<>====<====<>===<====<========	NM:i:46	AM:i:4	NH:i:2	YI:f:54.46	X1:Z:$1,0,40807085,40807142,0,00,32,3075,4058,6517,6517,,mmmSSSmmIIImmmmIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIImmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm$6,1,154470997,154471095,0,00,33,3754,4697,0,4697,,mSSSmmIIIImmImmSmmmIIIIIIIIIIIIIIImmmSmmSmmmmDDDDDDDDDDDDDDDDDDmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm	X2:Z:m3S3mmI3m4I40m46	X3:i:4058	X4:i:101	X5:Z:0	X6:i:2054
                      1 	369	chr5	154462998	5	1=3X2=4I2=1I2=1X3=15I3=1X2=1X4=18D8=1X47=	chr1	40799223	0	*	*	NM:i:45	AM:i:5	NH:i:2	YI:f:62.18	X1:Z:$1,0,40807085,40807142,0,00,32,3075,4058,6517,6517,,mmmSSSmmIIImmmmIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIImmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm$6,1,154470997,154471095,0,00,33,3754,4697,0,4697,,mSSSmmIIIImmImmSmmmIIIIIIIIIIIIIIImmmSmmSmmmmDDDDDDDDDDDDDDDDDDmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm	X2:Z:mS3mmI4mmImmSm3I15m3SmmSm4D18m8Sm47	X3:i:4697	X4:i:101	X5:Z:0	X6:i:34823
                      1 	147	chr1	40799223	44	101=	=	40799086	-238	TTTGTCATTTTGGCGAATTACTGGAAGGTGGCGTTTCTGGCCGTAAGGCTGATATTCTTCATTTTTAAACCCAATATAACCATCCTTTCCTGTAGACTCTT	========<<3===3===<333===<=====<====><==<========<======>>=>=>==><<=<=>>>==<=>=>=========><====<>====	NM:i:0	AM:i:40	NH:i:1	YI:f:100	X1:Z:$1,1,40807222,40807322,0,11,81,10090,10090,11079,11079,,mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm	X2:Z:m101	X3:i:10090	X4:i:101	X5:Z:0	X6:i:6159
                      The two alignments for the first read are at 62% and 54% identity, both of which are below what BBMap looks for at default settings.

                      Comment

                      • rkanwar
                        Junior Member
                        • Feb 2011
                        • 8

                        Thanks, that helps a lot !

                        Comment

                        • holmrenser
                          Junior Member
                          • Jul 2013
                          • 9

                          Hi Brian,

                          I am trying to extract reads from a bbmap sam-file using picard SamToFastq and get an error about unpaired reads. Whether I tell BBmap to output paired only or not, picard SamToFastq claims there are reads flagged as paired that are missing a pair.

                          BBmap command:
                          bbmap.sh ref=chloroplast.reference.fasta in=filter.temp.filtered.R1.fastq in2=filter.temp.filtered.R2.fastq threads=10 outm=folder/prefix.sam covstats=folder/prefix.covstats.txt basecov=folder/prefix.basecov.txt -Xmx10G fast=t keepnames=t machineout=t pairedonly=t

                          picard SamToFastq command:
                          picard.jar SamToFastq INPUT=folder/prefix.sam F=folder/prefix.R1.fastq F2=folder/prefix.R2.fastq FU=folder/prefix.unpaired.fastq

                          Error:
                          Exception in thread "main" htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Found 29230 unpaired mates

                          When I run it without the pairedonly=t option I get the following error:
                          Exception in thread "main" htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Found 61616 unpaired mates

                          Any suggestion?

                          Thanks in advance

                          Comment

                          • Brian Bushnell
                            Super Moderator
                            • Jan 2014
                            • 2709

                            That's odd. Your command looks fine. Unfortunately I will be gone until Monday and won't be able to look into this until then, but would you be able to email me the fastqs and reference? Or, ideally, a small subset of the reads that triggers the same problem.

                            Thanks,
                            Brian

                            Comment

                            • susanklein
                              Senior Member
                              • Feb 2014
                              • 116

                              Hi Brian,

                              is there any way to use bbmap to map very long reads from e.g. nanopore (minION).

                              Also I read on another thread that dedup.sh can be used to merge assemblies. Can it produce a consensus sequence?

                              Thanks very much.

                              S

                              Comment

                              • GenoMax
                                Senior Member
                                • Feb 2008
                                • 7142

                                BBMap can map reads of up to 6kb: http://seqanswers.com/forums/showpos...43&postcount=2

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                20 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                28 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                38 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...