Please help my BBMap cannot remove Illumina adapter

[TofuKaj]

Dear great helpers,

I'm an RNAseq starter and trying to find a good tool for fastq file preprocessing. I currently use BBmap to trim Illumina addapter using the command:

bbduk.sh -Xmx1g in1=f1.fq in2=f2.fq out1=clean1.fq out2=clean2.fq ktrim=r ref=truseq_rna.fa.gz k=28 mink=12 hdist=1

The f1.fq and f2.fq are from Illumina 1.9. When I check the output clean1.fq and clean2.fq files using FastQC. There is still evidence of adapter contamination.

GATCGGAAGAGCACACGTC 25845 0.18387555456141572 Illumina Multiplexing Adapter 1 (100% over 19bp)


I think this could be solved by adjusting parameters, but I'm too naive to do it. Would you please suggest me how to solve the problem?

Thank you very much in advance,
Kaj

[GenoMax]

It is not removing the adapters since you are missing a key option on your command line for bbduk .. the location of the file containing the sequence of the adapters.

Your command should be

$ bbduk.sh -Xmx1g in1=f1.fq in2=f2.fq out1=clean1.fq out2=clean2.fq ktrim=r ref=truseq_rna.fa.gz k=28 mink=12 hdist=1 ref=/path_to/bbmap-34.xx/bbmap/resources/truseq.fa.gz

Replace the truseq file with nextera if you are using those adapters.

[TofuKaj]

It is not removing the adapters since you are missing a key option on your command line for bbduk .. the location of the file containing the sequence of the adapters.

Your command should be

$ bbduk.sh -Xmx1g in1=f1.fq in2=f2.fq out1=clean1.fq out2=clean2.fq ktrim=r ref=truseq_rna.fa.gz k=28 mink=12 hdist=1 ref=/path_to/bbmap-34.xx/bbmap/resources/truseq.fa.gz

Replace the truseq file with nextera if you are using those adapters.

Thank you very much for your quick help
I'm so sorry
for my ambiguous post. In fact, I have added the path to my code but skipping it in the post. Please describe me a little bit more why you suggest the use of truseq.fa.gz instead of truseq_rna.fa.gz
Thank you very much in advance

[GenoMax]

Example you posted above looks like "TruSeq_Adapter". TruSeq_RNA adapters are different (TGGAATTCTCGGGTGCCAAGGAA). You can take a look at the adapter sequences in the "bbmap-34.xx/bbmap/resources" directory.

My apologies. I see that you have "ref=" in your original command line.

[Brian Bushnell]

If you're not sure which adapters are used, you can do "ref=truseq.fa.gz,truseq_rna.fa.gz,nextera.fa.gz" and get them all (this will increase the amount of overtrimming, though it should still be negligible). But as GenoMax said, that looks like a normal TruSeq adapter, not TruSeq RNA.

Also, as these are paired reads, I suggest you add the "tbo" and "tpe" flags to trim by overlap also, which will get rid of more adapter sequence.