Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • DNATECH
    Member
    • Mar 2015
    • 31

    First HiSeq 3000 data

    Hello,

    in case you are interested, we have posted some results from our first HiSeq 3000 runs as well as some information and considerations on the changes introduced by the new HiSeq 3000 and Hiseq 4000 sequencer generation. The yields on the first two runs were higher than expected at about 340 million reads per lane. The quality looks good.
    There is also link to the complete data from a PhiX lane (including the clusters that did not "pass filter").



    Btw, the cluster images do not give away the patterned character of the flowcells. Please see the attachment.

    Best,
    Lutz
    Attached Files
    Last edited by DNATECH; 05-07-2015, 12:48 AM.
  • DNATECH
    Member
    • Mar 2015
    • 31

    #2
    Some Q30 plots.
    Attached Files

    Comment

    • idedios
      Member
      • Mar 2014
      • 20

      #3
      Sweet my company just got one and we'll do our training run in a couple weeks from now. The instrument was setup and configured nearly a month ago so it's bothering to see it idle for so long.

      Comment

      • DNATECH
        Member
        • Mar 2015
        • 31

        #4
        We are actually waiting for flow-cells for several weeks; I guess Illumina is surprised that anybody wants to use the new sequencers?

        Comment

        • GenoMax
          Senior Member
          • Feb 2008
          • 7142

          #5
          @DNATECH: Based on this (and your other post) it sounds like you need "near perfect libraries" to get good data from patterned flowcells. This could be a problem for core facilities, where "variable" quality libraries come in from customers.

          It would be interesting to hear about your experiences as real world customer libraries start flowing through.

          Comment

          • pmiguel
            Senior Member
            • Aug 2008
            • 2328

            #6
            Originally posted by DNATECH View Post
            Hello,

            in case you are interested, we have posted some results from our first HiSeq 3000 runs as well as some information and considerations on the changes introduced by the new HiSeq 3000 and Hiseq 4000 sequencer generation. The yields on the first two runs were higher than expected at about 340 million reads per lane.
            You mean 340 million pass-filter clusters per lane?

            --
            Phillip

            Comment

            • pmiguel
              Senior Member
              • Aug 2008
              • 2328

              #7
              What final concentration was the phiX library that you clustered? I mean after neutralization?

              I mean is there no danger of overclustering anymore? That was what I was hoping for when I heard about the patterned flowcells...

              --
              Phillip

              Comment

              • DNATECH
                Member
                • Mar 2015
                • 31

                #8
                Yes, an average of 340 million clusters passing filter per lane.

                Originally posted by pmiguel View Post
                You mean 340 million pass-filter clusters per lane?

                --
                Phillip

                Comment

                • DNATECH
                  Member
                  • Mar 2015
                  • 31

                  #9
                  Hi Miguel,

                  the input was 5ul of PhiX at 2 nM. So far we have used 2 nM concentrations for all our libraries/lanes. Illumina recommends up to 3 nM.
                  From what our FAS told us, I got the impression under-loading could be more detrimental than over-loading.

                  Originally posted by pmiguel View Post
                  What final concentration was the phiX library that you clustered? I mean after neutralization?

                  I mean is there no danger of overclustering anymore? That was what I was hoping for when I heard about the patterned flowcells...

                  --
                  Phillip

                  Comment

                  • DNATECH
                    Member
                    • Mar 2015
                    • 31

                    #10
                    Hi GenoMax,

                    perhaps we are just being careful at the moment - since Illumina seems to be very careful and there is very little information so far. The customer samples (n=11) have been looking great so far except one; this sample had some larger low complexity component to it (which we were not aware off). For this sample the Q30 rates dropped after the first 60 to 70 bases of low complexity bases from 95% to 70%.

                    Originally posted by GenoMax View Post
                    @DNATECH: Based on this (and your other post) it sounds like you need "near perfect libraries" to get good data from patterned flowcells. This could be a problem for core facilities, where "variable" quality libraries come in from customers.

                    It would be interesting to hear about your experiences as real world customer libraries start flowing through.

                    Comment

                    • pmiguel
                      Senior Member
                      • Aug 2008
                      • 2328

                      #11
                      Originally posted by DNATECH View Post
                      Hi Miguel,

                      the input was 5ul of PhiX at 2 nM. So far we have used 2 nM concentrations for all our libraries/lanes. Illumina recommends up to 3 nM.
                      From what our FAS told us, I got the impression under-loading could be more detrimental than over-loading.
                      Wow, 2000 pM? I think the highest we ever went on the HiSeq2500 was 23 pM.

                      --
                      Phillip

                      Comment

                      • GenoMax
                        Senior Member
                        • Feb 2008
                        • 7142

                        #12
                        To get 2-2.5x more clusters (compared to a 2500) load 100x more? DNA binding in nanowells must not be very efficient.
                        Last edited by GenoMax; 05-08-2015, 11:35 AM.

                        Comment

                        • DNATECH
                          Member
                          • Mar 2015
                          • 31

                          #13
                          Hi Pmiguel,

                          the basic procedure looks like:
                          - 5 ul of library (2 nM to 3 nM including PhiX)
                          - add 5 ul 0,1 N NaOH
                          - add 5 ul Tris (200mM)
                          - add 35 ul Enzyme Master Mix
                          - load all 50 ul onto cBot

                          Originally posted by pmiguel View Post
                          Wow, 2000 pM? I think the highest we ever went on the HiSeq2500 was 23 pM.

                          --
                          Phillip

                          Comment

                          • Brian Bushnell
                            Super Moderator
                            • Jan 2014
                            • 2709

                            #14
                            I finally finished downloading these, and I'll take a look at the quality from mapping. But before I do that, I always trim adapters... but I was never sure what kind of adapters PhiX reads had. They don't exactly match any adapters in my list, so I'll call them "PhiX adapters". Here they are, for reference:

                            >Read1_adapter
                            AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTGAAA
                            >Read2_adapter
                            AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA

                            Also, at least for the first 4 million reads, 29.36% failed the chastity filter.

                            Comment

                            • DNATECH
                              Member
                              • Mar 2015
                              • 31

                              #15
                              Hi Brian,

                              Thanks for looking at the data. The files that I uploaded have 482,680,800 reads. The sequencer generates "reads" for each single nanowell - no matter if it is loaded or not. Thus, the figure of 30% or higher "failing" reads is expected. The SAV viewer indicates a total of 482.68 million nanowells. According to Illumina 60% to 70% of clusters passing filter are considered to be very good; because the figure is calculated with respect to the total number of nanowells. I did intentionally upload files including all non-passing reads (the majority of the "not passing filter" data are likely simply empty nano-wells though).

                              Lutz


                              Originally posted by Brian Bushnell View Post
                              I finally finished downloading these, and I'll take a look at the quality from mapping. But before I do that, I always trim adapters... but I was never sure what kind of adapters PhiX reads had. They don't exactly match any adapters in my list, so I'll call them "PhiX adapters". Here they are, for reference:

                              >Read1_adapter
                              AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTGAAA
                              >Read2_adapter
                              AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA

                              Also, at least for the first 4 million reads, 29.36% failed the chastity filter.
                              Last edited by DNATECH; 05-08-2015, 03:38 PM.

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-13-2026, 10:26 AM
                              0 responses
                              22 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              32 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              20 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              34 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...