[cur]

solexa adapter sequences for paired end data

Hi
I wonder if somebody can help me here....I have got some solexa data (paired end reads) and want to map these to the genome with bwa/maq...However when I did this only 20% of sequences mapped so I gather I want to check/ for presence of adapters in the sequences and then repeat the alignment after trimming of the data.

Which adapter sequences should I screen for- as this is paired end data I assume its the 5` to 3` sequence for the PE adpter 1 and 2 which I found in one of your posts?
Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

In fasta format:
>Solexa-PairedEndAdapter1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>SolexaPairedEndAdapter2
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

If I had single end solexa data would I then screen for the same adapters

Genomic DNA oligonucleotide sequences (from previous posting)
Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

[greigite]

Hi cur,

That is not quite right- you have to use the sequence of the PCR product produced by amplification of your library with paired end primers to identify sequences to screen out. You are looking for sequence between your insert and the flow cell oligo. This would appear in your product only if your insert was incredibly short (or nonexistent)- I suspect you may have sequenced a whole bunch of adapters. What did your Bioanalyzer trace look like? I've found that the molar ratio of amplified adapter sequence (~130 bp) to amplified library is pretty close to the percentage of adapter only reads you get.

I believe the following is right but others please correct if not:

Sequence between your insert and the flow cell oligo for Round 1 paired end:
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG

Sequence between your insert and the flow cell oligo for Round 2 paired end:
AGAAAGGGATGTGCTGCGAGAAGGCTAGA

For single read the appropriate sequence to screen out depends whether you prepped your libraries with single or paired end adapters.

[jsilhavy]

Illumina Index PE adaptor

Hi,

I purchased Illumina's multiplexing kit and ligated the index PE adaptor to my samples. However, I soon learned that this kit is not compatible with Agilent's SureSelect DNA Capture protocol (microarray based). I would still like to proceed with the library prep (have not added the barcodes/indexes) but was wondering if anyone knew the difference between Illumina's Index PE adaptor and standard PE adaptors.

Thanks!!

[clpX]

Re: Illumina Index PE adaptor

Hi jsilhavy,

the adapters are quite similar because the index is added in the PCR step and does not come with the adapters. I attach a file with the sequences that I found in some other post in this forum.

[cur]

Hi greigite
Thanks for the reply- in this case the answer was actually simple in the end- the sequencing service had not sent us the right data. Once we got the right data there was no problem with the alignment :-) what a relief

[AdamB]

Does anyone know the primer concentrations required for SE ChIP library preparation?

This is the information given in the protocol:

Prepare the following PCR reaction mix:
• DNA (36 μl)
• 5x Phusion* buffer (10 μl)
• dNTP mix (1.5 μl)
• PCR primer 1.1 (1 μl)
• PCR primer 2.1 (1 μl)
• Phusion* polymerase (0.5 μl)
The total volume should be 50 μl.

N.b. only 10 ng of DNA is used for the library preparation in the first place, so the primer concentrations might be lower than for whole genome DNA sequencing?

Thanks.

[AdamB]

I found the answer in another thread. Just to check, I called Illumina tech support, and they have confirmed the stock PCR primer 1.1 and 2.1 concentration is 25 uM.

[jchoo]

thanks,thats what i want,by the way weather all the illumina use the same adapter?

[kr067]

paired end seq

Hi all,
Im new to paired end mRNA seq. Are the adapters for the paired end seq same as the genomic DNA adapters?
Thanks

[sci_guy]

@kr067: No. Read the pdf posted by clpX above.

[kr067]

Thank you sci_guy! that was really helpful!

[amango]

I noticed that several people were wondering about adaptor and primer concentrations in the Illumina kit. I just spoke to an Illumina tech support person, and for RNA-seq at least, the working concentration for the adaptor oligo mix is 15 uM while PCR primers are 25 uM.

[mx1970]

Hi,
I want to do directional mRNA seq. I have to use the Small RNA Sequencing Primer during the primer hybridization.
Does anybody know at which concentration should I adjust this primer?
thanks

[AdamB]

I ordered the following primers from Sigma:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T

(HPLC-purified)
*=Phosphorothioate bond

However I can't get them working with my ChIP input DNA sample. Have tried varying the number of cycles, but each time after the PCR amplification of my library I only have 2 or 3 ng/ul, whereas colleagues have had more like 20 ng/ul.

I'm unsure whether the problem is with the primers or something else. As far as I know, everything apart from the primers is the same as colleagues' libraries that worked. I don't have any Illumina primer to test alongside.

[[email protected]]

PE indexed libraries

I'm trying to figure out what the final sequence of an Illumina PE indexed library is and where the enrichment primers and sequencing primers go. Has anyone figured out a schematic of generation of the PE indexed libraries showing all the sequence similar to the one I found on this forum for non-indexed PE libraries (see below).

dandestroy09-18-2008, 07:13 PM
Sorry for the small font, but that's the only way I could make it fit




PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
PE PCR Primer1:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
PE DNA Sequencing Primer1
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE DNA Sequencing Primer2
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'