Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • wisense
    Member
    • Sep 2011
    • 30

    CIGAR inconsist with read length. Does Bowtie2 reedit read sequence?

    Hi, guys

    I used bowtie2 to align paired-end reads to hg19 genome, and got the sam format output. Then when I tried to convert the sam into bam, I found some error information:
    Code:
    [samopen] SAM header is present: 25 sequences.
    Line 817574, sequence length 124 vs 125 from CIGAR
    Parse error at line 817574: CIGAR and sequence length are inconsistent
    So, I looked into the sam file, and found the line 817574 is like:
    Code:
    HISEQ04:185:C62CTANXX:3:1101:8017:19749	99	chr2	184686606	42	125M	=	184686727	246	TAGAAAAACTAAACAATGAACCGATAAAAAAACTACAACAACTTTTTAAGACGTAGATAATATAATACAATGTAAATAGAATCAACAAAAATTTTTTAAAATGAATGGTAAGAAAGGATTATTA	BBBBBFFFFFFFFFFFFFFFFFFFFFFFF<FFFFFFFFBFBFFFFFFFFFFBFFFFFFFFFFFFBFFFFFFFFBFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFBFFFF<F7F<FFFF<BF<F	AS:i:0	XN:i:0	XM:i:0	XO:i:0	XG:i:NM:i:0	MD:Z:125	YS:i:0	YT:Z:CP
    The CIGAR is 125M, which means the read is 125bp and each base is match/mismatch, while the read sequence is only 124bp. As I know, my paired-end reads are 125bp in sequencing. I think bowtie2 has reedited the sequence of the read, so I compared the sequence in the original fastq file and the bowtie2 alignment:
    Code:
    Seq in Fastq:
    TAGAAAAACTAAACAATGAACCGATAAAAAAACTACAACAACTTTTTAAGACGTAGATAATATAATACAATGTAAATAGAATCAACAAAAATTTTTTAAAATGGCACGATGAAGTTAAGGCATAG
    Seq in Bowtie2 alignment:
    TAGAAAAACTAAACAATGAACCGATAAAAAAACTACAACAACTTTTTAAGACGTAGATAATATAATACAATGTAAATAGAATCAACAAAAATTTTTTAAAATG[COLOR="Red"]AATGGTAAGAAAGGATTATTA[/COLOR]
    It's quite strange the tail bases of the sequence in the alignment are quite different from the fastq file. Somebody know how do this happen? Does Bowtie2 reedit the sequence when it align the read to the reference?

    If you have any idea, please reply me, thanks~
    wisense
    Last edited by wisense; 05-24-2015, 11:03 PM.
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    It sounds like the sam file got corrupted somehow; I'd suggest re-mappping. And, perhaps, upgrading to the latest version first in case that was a version-specific bug.

    Comment

    • wisense
      Member
      • Sep 2011
      • 30

      #3
      Originally posted by Brian Bushnell View Post
      It sounds like the sam file got corrupted somehow; I'd suggest re-mappping. And, perhaps, upgrading to the latest version first in case that was a version-specific bug.
      Hi, Brian
      Thanks for your reply.
      My Bowtie 2 version is 2.2.4, I will try the latest version 2.2.5 to see if there's any difference. By the way, there're about 33437 alignments in the sam file their sequence lengths are not 125bp, maybe ranging from 80-120 bp. Quite strange to me.

      Comment

      • Brian Bushnell
        Super Moderator
        • Jan 2014
        • 2709

        #4
        It sounds to me like two processes ran at the same time, one with 125bp reads and one with variable-length reads, and were writing to the same file... just a guess. I suggest you confirm the read count and length distribution of what you think was the input fastq - should be the same as the output sam. The BBMap package has a tool called readlength.sh that you can use to do that quickly.
        Last edited by Brian Bushnell; 05-26-2015, 09:48 AM.

        Comment

        • wisense
          Member
          • Sep 2011
          • 30

          #5
          Originally posted by Brian Bushnell View Post
          It sounds to me like two processes ran at the same time, one with 125bp reads and one with variable-length reads, and were writing to the same file... just a guess. I suggest you confirm the read count and length distribution of what you think was the input fastq - should be the same as the output sam. The BBMap package has a tool called readlength.sh that you can use to do that quickly.
          Before bowtie2 alignment, I used FastQC to analyze the paired-end reads and both read1 and read2 fastq are 125bp, not with variable-length. BTW, I have used the latest version of bowtie2 (v2.2.5) to re-align the reads to the genome, there's no such error in the alignment. Perhaps, this is a version-specific bug of bowtie2. Thanks for your good suggestion.

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            This is either a very very obscure bug or, more likely, Brian guessed correctly that you have two processes overwriting each other's output (or something along those lines). You might just rerun the alignment.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM
            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Today, 12:17 PM
            0 responses
            10 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, Yesterday, 11:41 AM
            0 responses
            11 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-20-2026, 11:10 AM
            0 responses
            23 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-13-2026, 10:26 AM
            0 responses
            37 views
            0 reactions
            Last Post SEQadmin2  
            Working...