[Dario1984]

Isaac (http://bioinformatics.oxfordjournals...ent/29/16/2041) was possibly designed for human data but should be usable for other genomes. Illumina has released pre-built indexes only for Hg19 but indexes can be built for other genomes (I have not tried it yet). Isaac aligner in HAS uses 32-mer seeds.

Another PhD student discovered it doesn't work for the sheep genome, which has | in the name of chromosomes.

e.g.

>gi|406684590|gb|CM001582.1| Ovis aries breed Texel chromosome 1, whole genome shotgun sequence
ATGGGGACATGACCGGGAGGTGGGCAAGGAGAGCGTCTACAGCTCAGGGGAGCCAGGGATCACCGCTCCC ...

I don't see the point of variant calling for a draft genome, though.

[colindaven]

So is anyone using Phi in bioinformatics these days ? We do have a great number of compute bound processes (blastx, blastx) in a productive pipeline which could be sped up.

I do wonder about the utility for typical IO and memory bound bioinformatics applications such as NGS though.

[westerman]

So is anyone using Phi in bioinformatics these days ? We do have a great number of compute bound processes (blastx, blastx) in a productive pipeline which could be sped up.

I do wonder about the utility for typical IO and memory bound bioinformatics applications such as NGS though.

I haven't found a good use for the Phi co-processor. As you imply -- IO and memory bound problems are not a good match.