Help with FastQC results

[ileanadrt]

Hi,
I have two sets of Illumina Single End RNA-Seq 50 bp data (two differents days of mammalian cell culture). The kit used was KAPA Stranded RNA-Seq Kit with RiboErase.

Unfortunately the results from FastQC are not as expected. But the problem is that I am not exactly sure how to interpret the data and what to say about the plots.

Both datasets show the same results. The plot of per base sequence quality is OK (I think) and also the plot of Adapter content, but the plots of GC content and Kmer content look very weird. Also, the duplication levels.

I am happy to get any advices about what is wrong in this data or possible explanations for this results.

Thanks for any help

Ileana

First three results of
Overrepresented sequences:
Sequence
CGACGGGGGGCCCCGCGGGGCCGAGAAGAAGAGGAGGGGGAGGCGAGGAGG Count: 187325
Percentage: 1.0857026079582217
Possible Source: No Hit

Sequence GGACAGGAGAGCGGTCGCGCCGTGGGAGGGGCGGCCCGGCCCCCACCGCGG Count: 98598
Percentage: 0.571456590094567
Possible Source: No Hit

Sequence CCCGAGACGAGTGGCTCTCCGCACCGGTCCCCGGTCCCGACGCGCGGCGGG Count: 95732
Percentage: 0.5548457603899987
Possible Source: No Hit

[GenoMax]

Out of the graphs you attached the GC content one looks rather strange. Is this known to be an extremely GC rich organism?

[ileanadrt]

No, the GC content is around 40%

[GenoMax]

Have you checked a few sequences (e.g. by blast) to see if they are from the right organism (and are not some kind of contamination)?

[ileanadrt]

I did a quick search and didn't found possible contamination. Could be some rRNA and / or mitochondrial RNA? I did found some of these.

[GenoMax]

Neither of those should skew GC content that way. Perhaps someone else will have further suggestions.

You should go ahead and start analyzing the data.

[nucacidhunter]

According to plots GC content of reads is 60%. This seems to be result of some GC rich reads with high duplication rates (20% has over 10 k dup rate). I would check reads with dup rate over 1k to see what they are and if they make bilogical sense. If they are not rRNA or from repetative regions, I would suspect some library prep issues.

[AdrianaGeldart]

Dear Ileanadrt,

I am a member of the Kapa Biosystems Technical Support Team.

We would love to help you troubleshoot this further. Would you be willing to share the type of mammalian cell line you are using?

Thanks and best regards,
Adriana