Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • DZhang
    Senior Member
    • Jun 2010
    • 177

    #16
    Hi Michael.James.Clark,

    Thank you for the clarfication. I did not know actually the difference was clearly documented. I learn a few new things in this field every day!

    This may be suited for a new thread but what's your view on duplicate removal for single-end reads?

    Regards,
    Douglas

    Comment

    • shruti
      Member
      • Mar 2010
      • 35

      #17
      Hi Michael,
      Thanks for the info. I was not aware of this limitation of rmdup.
      Will try Picard and see. (and next time I would be cautious of the filenames I write)

      Hi Dzhang,
      Thanks for the info on your pipeline.

      Comment

      • Glouglou14
        Junior Member
        • Jan 2011
        • 2

        #18
        Originally posted by shruti View Post
        Hi,

        I'm also facing the same problem here is case in question. The read names are same.

        HWI-ST220_63:6:2108:11340:115090 177 chr1 14480159 37 50M chr5 84273185 0 GCTACCACTCAGAAACTTGGAGAAATCACAGAGAGCCATGGACTTTATTT JIIHGIGJIJJIJHGIHGGJJJJJJJJIJJJIJJJIJGHHHHFFFFFCCC XT:A:U NM:i:0 SM:i:37 AM:i:3X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:50
        HWI-ST220_63:6:2108:11340:115090 113 chr5 84273185 37 50M chr1 14480159 0 AACAGAATTCCAGTGAGATACCTTCTTCCTTCTCAGGATTTTACATGTTA HHJIJJIIIJJJJJJJJIHDJJJIJIJJJJJIIJJJJHHHHHDFFFFCCC XT:A:U NM:i:0 SM:i:3AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:50
        HWI-ST220_63:6:1108:12937:121403 177 chr1 14480159 37 50M chr5 84273185 0 GCTACCACTCAGAAACTTGGAGAAATCACAGAGAGCCATGGACTTTATTT JIIGJIHGJJJJIHGJJJIJJJJJJIJHJIJIJJJIJHHHFHFFFFFCCC XT:A:U NM:i:0 SM:i:37 AM:i:3X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:50
        HWI-ST220_63:6:1108:12937:121403 113 chr5 84273185 37 50M chr1 14480159 0 AACAGAATTCCAGTGAGATACCTTCTTCCTTCTCAGGATTTTACATGTTA JJIIJIJIGJJGIIJJIGE;JJJJIIJJJJIIIJJJJHFHHHFFFFFCCC XT:A:U NM:i:0 SM:i:3AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:50

        Any pointers would be most appreciated.
        I had the same issue than shruti. Here is how i fixed it (in case is usefull for someone else...).
        Samtools rmdup was having trouble with "supplementary alignment". I removed them (samtools view -b -F 0x0800 foo.bam > foo.noSupAln.bam) and everything went fine.

        Comment

        • Momina
          Member
          • Aug 2015
          • 19

          #19
          hi
          from which file we have to remove duplicates either from file.bam or file.sorted.bam?

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #20
            It's simplest to remove duplicates from a sorted BAM file (in fact, most tools require that the input is sorted).

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
              by SEQadmin2



              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

              Despite this, “CRISPR helped turn genome editing from a specialized technique into
              ...
              07-31-2026, 11:01 AM
            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Yesterday, 12:22 PM
            0 responses
            16 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-11-2026, 10:35 AM
            0 responses
            16 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-06-2026, 07:41 AM
            0 responses
            31 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 08-03-2026, 10:13 AM
            0 responses
            50 views
            0 reactions
            Last Post SEQadmin2  
            Working...