Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • clueheart
    Junior Member
    • Feb 2015
    • 3

    Hi,

    i am uncertain what is the actual sequence of the read2 primer on Hiseq, PE amplicon sequencing.

    To my understanding it should be HP11.

    Is ATCTCGTATGCCGTCTTCTGCTTG the correct sequence for HP11 ?

    Comment

    • pmiguel
      Senior Member
      • Aug 2008
      • 2328

      Originally posted by clueheart View Post
      Hi,

      i am uncertain what is the actual sequence of the read2 primer on Hiseq, PE amplicon sequencing.

      To my understanding it should be HP11.

      Is ATCTCGTATGCCGTCTTCTGCTTG the correct sequence for HP11 ?
      To the best of my knowledge Illumina never shares the sequences of their primers. Adapters, yes. Primers, no.

      --
      Phillip

      Comment

      • enum
        Junior Member
        • Jul 2015
        • 2

        Hi,

        I'm following the protocol from this TCR sequencing paper: http://www.nature.com/nbt/journal/v3.../nbt.2938.html

        The PE primers they used are:
        PEprimerl AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
        PEprimer2 AAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

        Should I tell sequencing center to use P5 and P7 primers for MiSeq for the PCR product? I can see P5 primer sequence in PEprimer1 but PEprimer2 doesn't have exact P7 sequence. It lacks first "C"? Could anyone help me?

        Thank you!

        Comment

        • troubleble
          Junior Member
          • Sep 2011
          • 1

          (reply to clueheart)

          Just wanna remind you:
          HP11 combines at least 2 kinds of sequencing primer.
          The sequence you posted should be one of them, but I dont know the exact letter too, maybe no one knows except Illumina.
          btw, the other primer should fit NextEra system.

          Comment

          • ajthomas
            Senior Member
            • Mar 2010
            • 167

            Originally posted by ssully View Post
            I'm quite lost. I've got a set of paired end 100 nt HiSeq reads (library insert size was ~300bp) from a colleague and I can't determine what adapter sequences to trim. The current Illumina letter to customers lists a variety of sequences. Can someone explain the use of this set



            versus this set?



            For a paired end set that includes indices (barcodes) which set would have been used?


            Also, what are the 2 sequences of the oligos that coat a paired end flowcell used in the current HiSeq platform? (these would be sequences complementary to adapters sequences)
            I've been trying to sort this out to order some primers to use for making amplicon libraries on the Fluidigm Access Array. The Fluidigm protocol uses non-standard sequences (and therefore custom sequencing primers), and is not compatible with PE sequencing. I want to modify it to use standard Illumina sequences so that the libraries are PE compatible and fit better into the Illumina ecosystem.

            The confusion comes from these adapter sequences:
            PE PCR Primer 2.0
            5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
            PE Read 2 Sequencing Primer
            5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

            Multiplexing PCR Primer 2.0
            5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
            Multiplexing Read 2 Sequencing Primer
            5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
            The sequence of the adapter used to attach the i7 adapter (and index) is different. Either one should work to make a library, but the problem will come when sequencing read 2 and reading the first index. A different sequencing adapter will be needed. Which is the correct sequence?

            Comment

            • HESmith
              Senior Member
              • Oct 2009
              • 512

              Originally posted by ajthomas View Post
              Which is the correct sequence?
              The sequences that you list are from the earliest version of Illumina multiplexing, which was supplanted by the TruSeq platform several years ago. If you want your adapter sequences to be compatible with the current generation of sequencing and index primers, download the Customer Sequence Letter from Illumina and use the TruSeq v1/v2 (pp. 12-13) Universal Adapter plus the reverse complement of the Truseq Indexed Adapter (plus 3' A) to design your amplicon primers. If you require dual indexing, use the TruSeq HT sequences (D500 + D700 rev comp, pp. 10-11) as the basis of your design.

              Comment

              • ajthomas
                Senior Member
                • Mar 2010
                • 167

                Originally posted by HESmith View Post
                The sequences that you list are from the earliest version of Illumina multiplexing, which was supplanted by the TruSeq platform several years ago. If you want your adapter sequences to be compatible with the current generation of sequencing and index primers, download the Customer Sequence Letter from Illumina and use the TruSeq v1/v2 (pp. 12-13) Universal Adapter plus the reverse complement of the Truseq Indexed Adapter (plus 3' A) to design your amplicon primers. If you require dual indexing, use the TruSeq HT sequences (D500 + D700 rev comp, pp. 10-11) as the basis of your design.
                I got those sequences from the copy of the letter that I downloaded about a month ago. It is dated August 2014 and is the current version available from Illumina today. If those are old sequences that are no longer supported, Illumina needs to make it clear in the letter that they are obsolete and included only for legacy reasons.

                The sequences I listed that are labeled for multiplexing are the same as those listed for TruSeq, so I've been tempted to go with those. However, I can't be sure because there are so many different sequences out there. Both the Nextera and small RNA sample prep kits use still different sequences. Furthermore, a recent publication (Nature Methods, published last year) from which I and some colleagues are trying to replicate some methods used oligos that match the PE sequences listed earlier, not the TruSeq sequences. It seems that Illumina is still using a few different adapter sequences, and I don't understand how that can be.

                Comment

                • HESmith
                  Senior Member
                  • Oct 2009
                  • 512

                  The document (yes, you have the latest version) lists all of the adapter sequences ever offered by Illumina (or Nextera, whose technology it acquired). The methods have evolved, from single-end to paired-end sequencing, and unindexed to single indexing to dual indexing. All of those changes have required changes in the adapter sequences (and sequencing/indexing primers). And Illumina does offer a separate document that indicates which of their library prep versions are or are not compatible with which sequencing kits/versions.

                  Publications are a lagging indicator, so the sequences in a paper may be obsolescent by the time of release.

                  I explicitly stated which adapters are compatible with the current version of sequencing. Your service provider should be able to verify this information for you, and/or assist you with primer design.

                  Comment

                  • VC87
                    Member
                    • Oct 2015
                    • 18

                    Hi everyone!
                    Does anyone knows if/how is ir possible to distinguish kmer plots in FASTQC of reads derived from RRBS librarys from reads that just have bad quality?thanks in advance

                    Comment

                    • Brian Bushnell
                      Super Moderator
                      • Jan 2014
                      • 2709

                      I think the easiest thing to do would be to filter out low-quality reads and then run FastQC on the high-quality reads to see if they have any problems. This is a bit tangential to the topic, but for example you can remove low-quality reads with BBDuk using the maq (min average quality) flag, like "maq=15".

                      On a more thread-related note, the BBMap package has all of the Illumina adapter sequences in a fasta file which is more convenient than Illumina's PDF format. It's in /bbmap/resources/adapters.fa once you unzip/untar the package. As pmiguel indicated, this is just adapters; there are a lot of other sequences that Illumina considers proprietary and forbids sharing.

                      I'd also like to note that if you have paired-end reads with an unknown adapter sequence, you can discover it with BBMerge like this:

                      bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa

                      This tends to be useful in situations like discovering PhiX adapters, which are not in Illumina's customer letter.
                      Last edited by Brian Bushnell; 05-28-2016, 07:57 AM.

                      Comment

                      • VC87
                        Member
                        • Oct 2015
                        • 18

                        Thanks Brian, i will definitely have a look at BBDuk!

                        Comment

                        Latest Articles

                        Collapse

                        ad_right_rmr

                        Collapse

                        News

                        Collapse

                        Topics Statistics Last Post
                        Started by SEQadmin2, 06-05-2026, 10:09 AM
                        0 responses
                        16 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 06-04-2026, 08:59 AM
                        0 responses
                        34 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 06-02-2026, 12:03 PM
                        0 responses
                        37 views
                        0 reactions
                        Last Post SEQadmin2  
                        Started by SEQadmin2, 06-02-2026, 11:40 AM
                        0 responses
                        24 views
                        0 reactions
                        Last Post SEQadmin2  
                        Working...