Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • DrYak
    Member
    • Sep 2013
    • 13

    #1

    Subsetting a fasta file based on a set of BLAST results

    Hi,

    I have assembled a de novo transcriptome from my species of interest using trinity. The species has an internal symbiont (algae) and those sequences were obviously sequenced along with it. I have done a blast on my assembly which has ID'd a number of contigs corresponding to the symbiont. I would like to use the results of the blast to remove those contigs from the assembly into a new file so I can deal with the two organisms separately. It there an easy way to do this?

    I have cleaned up the trinity fasta output so it has a single unique ID for each contig like so:
    >TR1-c0_g1_i1
    AGCTGTTTGGCCAAGGCTGCGGCCTGGTGGCAGCCTTGCGAGAGCAAGGGCAGCAAGGGC (etc...)

    I have extracted the sequence IDs from the symbiont BLAST flatfile output using cut (id-symb) and then made another file with all the IDs of the symb blast hits removed from the full id file, thus representing the "host" sequences (id-host), using sort and uniq.

    I therefore have the following.
    combined.fasta (trinity output of all the contigs)
    id-symb (single column text file of the IDs extracted from a blast search against the symbiont transcriptome)
    id-host (single column text file of the all the IDs from the combined.fasta file minus the id-symb IDs)

    I would like to generate the following:
    symb.fasta = all those sequences in the combined.fasta from the id-symb list
    and
    host.fasta = the rest (i.e. combined.fasta - symb.fasta) aka all those sequences in the combined.fasta from the id-host list

    I've been trying to use a looped fasgrep (from the FAST perl module) but that is far too slow (has taken more than a day to get through less than 10% of the file) so I'm sure there must be a better way.

    The assembly contains ~250,000 contigs.


    Thanks.
  • SylvainL
    Senior Member
    • Feb 2012
    • 180

    #2
    Using R, quite easy and fast...

    library(Biostrings)

    all_fasta <- read.DNAStringSet("combined.fasta") ## You have to give the path to your file combined.fasta

    id_symb <- scan("id_symb", what="character", sep="\n")

    symbFasta <- all_fasta[names(all_fasta) %in% id_symb]
    hostFasta <- all_fasta[! names(all_fasta) %in% id_symb]

    Comment

    • GenoMax
      Senior Member
      • Feb 2008
      • 7142

      #3
      Another option is Jim Kent's faSomeRecords utility. I am linking the linux version but he has source/OS X executables available as well.



      faSomeRecords - Extract multiple fa records
      usage:
      faSomeRecords in.fa listFile out.fa
      options:
      -exclude - output sequences not in the list file.

      Comment

      • DrYak
        Member
        • Sep 2013
        • 13

        #4
        faSomeRecords = lifesaver

        Thank you so much genomax - that took less than 2 seconds for each file. The other way was still chugging away after two days...

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM
        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM
        • SEQadmin2
          Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
          by SEQadmin2



          Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
          ...
          07-09-2026, 11:10 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 07-31-2026, 02:55 AM
        0 responses
        19 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-24-2026, 12:17 PM
        0 responses
        16 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-23-2026, 11:41 AM
        0 responses
        16 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-20-2026, 11:10 AM
        0 responses
        26 views
        0 reactions
        Last Post SEQadmin2  
        Working...