Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • carmeyeii
    Senior Member
    • Mar 2011
    • 137

    #46
    Hi!

    I'm analyzing a "second-hand" dataset generated using SOLiD 4. It is a transcriptome mate pair library that is 52 x 37 nt, and I cannot for the sake of me find the protocol that was used to generate those specific read lengths. I have F3 and R3 reads, so I am assuming it is a circularization protocol, but I do not know what the size selection parameters were, or how the circles were cut to produce the final fragments. This info would be very valuable for a more accurate mapping.

    Any knowledge would be greatly appreciated!

    Thanks a lot,

    Carmen

    Comment

    • naveedakhtar
      Junior Member
      • Jun 2013
      • 2

      #47
      to [QUOTE=ECO;1350]biocc,

      Originally posted by ECO View Post
      biocc,

      "paired end" or "mate pair" refers to how the library is made, and then how it is sequenced. Both are methodologies that, in addition to the sequence information, give you information about the physical distance between the two reads in your genome.

      For example, you shear up some genomic DNA, and cut a region out at ~500bp. Then you prepare your library, and sequence 35bp from each end of each molecule. Now you have three pieces of information:

      --the tag 1 sequence
      --the tag 2 sequence
      --that they were 500bp ± (some) apart in your genome

      This gives you the ability to map to a reference (or denovo for that matter) using that distance information. It helps dramatically to resolve larger structural rearrangements (insertions, deletions, inversions), as well as helping to assemble across repetitive regions.

      Structural rearrangements can be deduced when your read pairs map to a reference at a distance that is substantially different from how that library was constructed (~500bp in the above example). Let's say you had two reads that mapped to your reference 1000bp apart...this suggests there has been a deletion between those two sequence reads within your genome. Same thing with an insertion, if your reads mapped 100bp apart on the reference, this suggests that your genome has an insertion.

      Mapping over repeats is similar...if one read is unmappable because it falls in a very repetitive region (eg. LINE, LTR, SINE), but the other is unique, you can again use that distance information to map both reads. The first read would likely come from the repeat that is ~500bp away from your unique second read.

      Hope that helps. It's a weird concept at first, but very useful for all types of sequencing. It's been around at some levels since the days of shotgun sequencing.

      And lastly, the terminology between "paired end" and "mate pair" is typically that "paired end" refers to sequencing both ends of the same molecule, while "mate pair" (in ABI's case) refers to sequencing only two tags (made by Type IIS restriction enzymes a la SAGE) from the ends of a typically much larger molecule. I could be wrong here though...
      how can paired end sequencing detect inversion? that you mentioned it along the detection of strucural rearrangment?

      Comment

      • naveedakhtar
        Junior Member
        • Jun 2013
        • 2

        #48
        my another question is that in the whole genome shot gun assembly the paired end sequencing of large insert clone, specially prepared, used as strategy to overcome the genome assembly problem due to repetitive sequences in the sequencing of complex genome. how does paired end sequencing perform this in the absence of a reference genome?

        Comment

        • mastal
          Senior Member
          • Mar 2009
          • 666

          #49
          what is a paired-end read?

          Originally posted by naveedakhtar View Post
          my another question is that in the whole genome shot gun assembly the paired end sequencing of large insert clone, specially prepared, used as strategy to overcome the genome assembly problem due to repetitive sequences in the sequencing of complex genome. how does paired end sequencing perform this in the absence of a reference genome?
          You use a program that does de novo assembly (velvet, abyss, mira, soapdenovo, many others). If there is a reference genome of a related species you can use that as a reference for the assembly. Having paired reads can help to scaffold the contigs.

          Comment

          • OTU
            Member
            • May 2013
            • 44

            #50
            Hi all!

            I have a question... Found in some old papers (1999) a term "forward-reverse constraints". The question is - is this term the same as "paired-end reads"???

            OTU

            Comment

            • westerman
              Rick Westerman
              • Jun 2008
              • 1104

              #51
              No. Not the same as 'paired-end reads' although it has to do with paired-end. Google the term. That should be enlightening.

              Comment

              • binlangman
                Member
                • Dec 2013
                • 11

                #52
                what is the paired-end distance?

                I read papers, and they mentioned 'the paired-end distance' many times. What is the paired -end distance?
                Example:
                If |-----75----|----------------------100-----------------|-----75-----|,
                and paired-end data both 75bp, and in this case,the paired-end distance is 100 or 250 or others?

                Thanks!

                Comment

                • mastal
                  Senior Member
                  • Mar 2009
                  • 666

                  #53
                  It could be either 250 or 100.

                  Different software packages may have their own definition of 'insert length', so it's best to read the documentation carefully.

                  For example, in the case you have illustrated, velvet would define the 'insert length' as 250.

                  This is the definition given in the velvet manual:

                  "The insert length is understood to be the length of the sequenced fragment, i.e. it includes the length of the reads themselves."



                  Bowtie2 also uses the same definition of fragment length.

                  Comment

                  • mido1951
                    Senior Member
                    • May 2014
                    • 123

                    #54
                    how to do an assembly if we have paired end reads? (two files R1.fq and R2.fq)?
                    thankyou

                    Comment

                    • OTU
                      Member
                      • May 2013
                      • 44

                      #55
                      What is your data on? Metagenome, single genome?
                      What sequencing platform did you use? What is the processing computer power that you can use?

                      Comment

                      • mido1951
                        Senior Member
                        • May 2014
                        • 123

                        #56
                        I have llumina paired end data.
                        I want to make an assembly of these data.
                        But the problem I do not understand the two F1.fq file and F2.fq.
                        Is that reads and reads of F1.fq F2.fq are complementary or not?
                        for the assembly do I have to overlap F1.fq or I have to overlap and F1.fq F2.fq?
                        thanky

                        Comment

                        • GenoMax
                          Senior Member
                          • Feb 2008
                          • 7142

                          #57
                          Originally posted by mido1951 View Post
                          I have llumina paired end data.
                          I want to make an assembly of these data.
                          But the problem I do not understand the two F1.fq file and F2.fq.
                          Is that reads and reads of F1.fq F2.fq are complementary or not?
                          for the assembly do I have to overlap F1.fq or I have to overlap and F1.fq F2.fq?
                          thanky
                          Cross-posted: https://www.biostars.org/p/162806/

                          @mido1951: See this page for a simple explanation of "shotgun sequencing": https://en.wikipedia.org/wiki/Shotgun_sequencing In the past people used sanger sequencing for this, which has now been replaced with NGS.

                          R1/R2 are merely sequences from the two ends of a fragment. They do not need to be complementary (in fact in most cases they will not be). You do not need to worry about R1/R2 reads individually but use them as a set for assembly.

                          Comment

                          • mido1951
                            Senior Member
                            • May 2014
                            • 123

                            #58
                            for example:
                            we have the sequence: S1: ATCGTTGAGCAGACT and the sequence S2: TGAGCAGACTTAAGTAGTTTT .
                            and for example, was the first sequenced reads from S1: R1 = ATCGTTGAG
                            R2 = AGTCTGCTC (reverse complement from the right)
                            and from the second sequence: R1: TGAGCAGAC
                            R2: AAAACTACT (reverse complement from the right)
                            So we have the two files paired end:
                            F1.fq:
                            S1: R1=ATCGTTGAG
                            S2: R1=TGAGCAGAC
                            F2.fq:
                            S1: R2=AGTCTGCTC
                            S2: R2=AAAACTACT

                            in the assembly here there is an overlap between R1(S1) and R1(S2).
                            in assembly, we can have overlap between R1 and R2 from two differents sequence??
                            Last edited by mido1951; 10-22-2015, 01:55 PM.

                            Comment

                            • OTU
                              Member
                              • May 2013
                              • 44

                              #59
                              Don't see why
                              "F1.fq:
                              S1: R1=ATCGTTGAG
                              S2: R1=TGAGCAGAC " would overlap. They only match at 3 bp. Assemblers won't combine them.

                              Comment

                              • mido1951
                                Senior Member
                                • May 2014
                                • 123

                                #60
                                I speak of an example.
                                it is assumed that it is an overlap.
                                I want to create an assembly tool but first I need to know how to detect overlap between the paired ends (from two files). and make assembly with paired end.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                23 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                213 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-13-2026, 10:26 AM
                                0 responses
                                79 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...