MinIon reads

[mido1951]

Hello,
I want to know is this the Minion sequencing generates two files as Illumina (paired end) of the first brain DNA (file1_R1) and second brain (file2_R2) its complement?

thankyou

[Brian Bushnell]

No, it generates a single file with 1D reads (those that were read once) and 2D reads (those that were read both forward and reverse, which are presented as a single consensus sequence).

[mido1951]

So the only file present forward and reverse ? or a single brain?

[Brian Bushnell]

I'm not sure what you mean by brain. There is one output file, and it contains unpaired reads.

[GenoMax]

I think @mid01951 is referring to "strand"?

[mido1951]

excuse me. Yes, brain is strand.
I mean the file has only one strand? not like Illummina, the two strand present it in two files?

[GenoMax]

Per Brian's answer in #2, the file has one sequence per read. If it happens to be a 2D read then the sequence is consensus of the two reads from the two strands.

[mido1951]

Thanks for your help.
But I want to know how Minion generates a sequence from the two strand?

[GenoMax]

Thanks for your help.
But I want to know how Minion generates a sequence from the two strand?

https://www.youtube.com/watch?v=CE4dW64x3Ts

[mido1951]

MinIon reads

Hello,
I want to know more about the method of sequencing Minion.
I read sequencing method and according to my understanding, MinION read the entire DNA fragment in both directions and produces a sequence consensus "2D".
I want to make an example.
we suppose this DNA fragment: image attached

So the consensus sequence(read from MinIon) is:

ATGAGGATCAGCCGCAAGCGGAATACTGCCTAGTCGGCGTTCGCCTT

am i right?
thanks

[AllSeq]

No, not quite. 2D reads are from double stranded molecules with a hairpin on one end. So if it starts reading from the 5' end, it would continue reading both strands from 5' to 3' (unless that's backwards and the enzyme processes in the other direction - 3' to 5'). This would yield the following sequence:

ATGAGGATCAGCCGCAAGCGGAA*TTCCGCTTGCGGCTGATCCGTCAT

Where "*" would be some sort of hairpin sequence.

But this isn't a 'consensus sequence' - the consensus sequence would be built up from multiple 2D reads.

[mido1951]

thank you for your explanations.
I say "consensus sequence"that is the read generated by this DNA fragment (this is just an example to understand the sequencing method Minion)

So the read is: ATGAGGATCAGCCGCAAGCGGAATTCCGCTTGCGGCTGATCCGTCAT

am I right?

THanks

[Chipper]

No, the 2d read would be ATGAGGATCAGCCGCAAGCGGAA (or as close as it gets given the error rate). In this case ATGAGGATCAGCCGCAAGCGGAA would also be given as the forward (template) read, and TTCCGCTTGCGGCTGATCCGTCAT the reverse read.

[mido1951]

but the sequencer generates a single Minion read.
there is no foward and reverse just one read.
am i right?