By how much custom primers can overlap adapters?

[Xaki]

By how much 5' ends of custom sequencing primers are allowed to overlap with the P5 and P7 flow cell adapters on MiSeq cell?
More specifically, with these sequences:
P5: 5' AATGATACGGCGACCACCGA 3'
P7: 5' CAAGCAGAAGACGGCATACGA 3'

Has anyone tried complete overlap?

Thanks

[bunce]

Hi Xaki, yes we tried a complete overlap with no success. Still not 100% why this didn't work but we gave up after about 3-4 runs (and tried a lot of things). So we ended up using a custom primer. The custom primer we use overlaps 4 bp. however our p5 is:
P5 5'-AATGATACGGCGACCACCGAGATCTACAC-3'

And our first 4bp of our custom primer (p5 end) is 5'-ACAC......

in total our custom primer is 22bp and contains some LNA's to keep the size down a bit and the melt temp high.

hope this helps, regards, Mike.

[Xaki]

Thank you bunce. This is helpful to know that complete overlap does not work. I wonder why? Do you see clusters forming at all?
Your primer design is same as ours. We also start from ACAC...
Has anyone tried to go a bit deeper into flow cell adapters sequence?

[bunce]

Hi Xaki. Yes - clusters formed. I am not sure why we could never get decent sequences. I suspect it might be that the 'vision' that all the libraries are lined up as nice organised vertical strands of DNA is misleading.... and that a lot of clusters exist in a bridged form. This represents an issue when trying to sneak in a custom primer. We tried altering the run recipe (annealing temp) to try and get the sequencing primer to bind before a cluster could bridge. But eventually gave up - the sequencing efficiency was too low.

The flow cell grafted P5 has a 'U' to enable cleavage of the strand - I think this is why it may not be possible to steal a few more bases? not really sure. Cheers Mike.

[Xaki]

There is a similar thread here. Some think you can extend custom sequencing primer into flow cell adapter with no problems, but I do not see anyone with direct experience doing that and getting good results.