Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • discoveradnan
    Member
    • Oct 2015
    • 23

    #1

    Confusion about Pooling Libraries and Clustering

    Hello everyone!


    According to TruSight Rapid Capture lib prep method, 50ng (5ng/ul) input DNA is required in a final volume of 10ul for one library. So if we want to pool different libraries (Lets say 10) what should be the final concentration and volume of our pooled libraries?

    Also, what should be the final concentration of DNA for optimum clustering?

    Thanks!
  • jwfoley
    Senior Member
    • Jun 2009
    • 183

    #2
    Are you asking about the amount of DNA you use for library prep, or the amount of library you use for sequencing?

    The final amount of library you use for sequencing is 5 uL @ 4 nM, at least on a few of the systems I've worked with - check the user guide for your machine (e.g. "Preparing Libraries for Sequencing on the MiSeq). So after you make, quantify, and QC 10 libraries, assuming you want equal depth for all of them, you would mix them to make a final solution in which each is 0.4 nM.

    Or if it's the amount of DNA you use for library prep, I wouldn't try to reduce the amount you put into the kit, because the reagent concentrations are optimized for a certain concentration of input DNA (tagmentation is particularly sensitive), and if it worked with less than 50 ng, Illumina would happily say so. So if you are preparing 10 libraries, you need 50 ng of input DNA for each one, or 500 ng total.

    Comment

    • discoveradnan
      Member
      • Oct 2015
      • 23

      #3
      Originally posted by jwfoley View Post
      Are you asking about the amount of DNA you use for library prep, or the amount of library you use for sequencing?

      The final amount of library you use for sequencing is 5 uL @ 4 nM, at least on a few of the systems I've worked with - check the user guide for your machine (e.g. "Preparing Libraries for Sequencing on the MiSeq). So after you make, quantify, and QC 10 libraries, assuming you want equal depth for all of them, you would mix them to make a final solution in which each is 0.4 nM.

      Or if it's the amount of DNA you use for library prep, I wouldn't try to reduce the amount you put into the kit, because the reagent concentrations are optimized for a certain concentration of input DNA (tagmentation is particularly sensitive), and if it worked with less than 50 ng, Illumina would happily say so. So if you are preparing 10 libraries, you need 50 ng of input DNA for each one, or 500 ng total.
      Thanks for your reply Jwfoley.
      Actually according to truSight rapid capture protocol, In DNA Input Recommendations section on Page 3, it is mentioned that 50ng of total gDNA is recommended per library. So after quantification, normalization of sample to 5ng/ul is required in a final volume of 10ul (50ng total). Confusion arises in my mind when in Pooling libraries section on Page 23,24, Illumina recommends using 500ng of each DNA library in a total volume of 40ul. i.e for pooling 2 libraries. 1000ng is required in total volume of 40ul. So first they told that 50ng is required and after that in pooling they mentioned 500ng per library. I maybe missing out something which is causing confusion. So need your kind guidance in this regard. Thanks a lot

      Here is the link for TruSight Rapid Capture Protocol for your reference.

      Last edited by discoveradnan; 12-01-2015, 06:57 AM.

      Comment

      • jwfoley
        Senior Member
        • Jun 2009
        • 183

        #4
        Oh, so you're asking about a third thing, the pooling after library prep but before target enrichment.

        The steps are, roughly:
        1. Isolate 50 ng gDNA from each sample
        2. Normalize each gDNA sample to 5 ng/uL
        3. Perform library prep on each sample with a distinct index
        4. Quantify & optionally QC each library
        5. Pool libraries
        6. Perform target enrichment on library pool
        7. Quantify & QC target-enriched library pool
        8. Use 5 uL @ 4 nM to sequence


        So yes, the more libraries you pool in one batch at step 5, the more of your library yield from step 3 is wasted. But changing the reaction conditions at step 3 will cause it to fail, so don't do that. You must use 50 ng gDNA per library prep, then there's a PCR amplification, which is how you end up with over 500 ng amplified library after step 3.

        Comment

        • discoveradnan
          Member
          • Oct 2015
          • 23

          #5
          Originally posted by jwfoley View Post
          Oh, so you're asking about a third thing, the pooling after library prep but before target enrichment.

          The steps are, roughly:
          1. Isolate 50 ng gDNA from each sample
          2. Normalize each gDNA sample to 5 ng/uL
          3. Perform library prep on each sample with a distinct index
          4. Quantify & optionally QC each library
          5. Pool libraries
          6. Perform target enrichment on library pool
          7. Quantify & QC target-enriched library pool
          8. Use 5 uL @ 4 nM to sequence


          So yes, the more libraries you pool in one batch at step 5, the more of your library yield from step 3 is wasted. But changing the reaction conditions at step 3 will cause it to fail, so don't do that. You must use 50 ng gDNA per library prep, then there's a PCR amplification, which is how you end up with over 500 ng amplified library after step 3.
          Thanks a lot Jwfoley. This confusion about pooling libraries has been cleared.
          I have seen in many posts and literature which recommends diluting library to 8-12pM in a final volume of 600ul for Illumina MiSeq. What are your thoughts about it? Is that concentration and final volume mandatory?

          Comment

          • jwfoley
            Senior Member
            • Jun 2009
            • 183

            #6
            Originally posted by discoveradnan View Post
            Thanks a lot Jwfoley. This confusion about pooling libraries has been cleared.
            I have seen in many posts and literature which recommends diluting library to 8-12pM in a final volume of 600ul for Illumina MiSeq. What are your thoughts about it? Is that concentration and final volume mandatory?
            This is just the older version of the standard protocol (for step 8 above). For the current MiSeq v3 kits, you start with 5 uL @ 4 nM, then add NaOH to denature it, then dilute this mix to 1000 uL (so it's now 20 pM), and load 600 uL of that into the reagent cartridge. For the older v2 kits, people instead started with a 2 nM library pool and thus ended up with 10 pM. Perhaps the posts you saw are from the v2 days? In my experience, loading 20 pM with a v3 kit gets just about exactly 25M clusters as expected, but I know people who go slightly higher to get slightly more data.

            See "Preparing libraries for sequencing on the MiSeq".

            Comment

            • discoveradnan
              Member
              • Oct 2015
              • 23

              #7
              Originally posted by jwfoley View Post
              This is just the older version of the standard protocol (for step 8 above). For the current MiSeq v3 kits, you start with 5 uL @ 4 nM, then add NaOH to denature it, then dilute this mix to 1000 uL (so it's now 20 pM), and load 600 uL of that into the reagent cartridge. For the older v2 kits, people instead started with a 2 nM library pool and thus ended up with 10 pM. Perhaps the posts you saw are from the v2 days? In my experience, loading 20 pM with a v3 kit gets just about exactly 25M clusters as expected, but I know people who go slightly higher to get slightly more data.

              See "Preparing libraries for sequencing on the MiSeq".
              Yeah jwfoley, You are right. Those posts must be about v2 kits.
              What about those kits which already include denaturation steps in their library prep protocol? e.g trusight rapid capture or truseq kits? If they don't need to undergo denaturation step as mentioned by you then how are they processed further after Step 8 ?
              Last edited by discoveradnan; 12-01-2015, 10:46 AM.

              Comment

              • jwfoley
                Senior Member
                • Jun 2009
                • 183

                #8
                Originally posted by discoveradnan View Post
                What about those kits which already include denaturation steps in their library prep protocol? e.g trusight rapid capture or truseq kits? If not then how are they processed further after Step 8 ?
                The protocol you linked has another round of PCR after the target enrichment, so you'll still come out of it with double-stranded libraries.

                Comment

                • discoveradnan
                  Member
                  • Oct 2015
                  • 23

                  #9
                  Originally posted by jwfoley View Post
                  The protocol you linked has another round of PCR after the target enrichment, so you'll still come out of it with double-stranded libraries.
                  Got your point jwfoley. Can you kindly guide me about libraries which are prepared from 2 round PCR? For your reference, I have linked the protocol below.

                  Does the nextera adapters, P5 and P7 (for binding with flow cell) and nextera transposase adapters (for sequencing primers to sequence gene of interest) used by this protocol is compatible with latest MiSeq Reagent Kit v2 flow cell and sequencing primers ,Read 1 (HP10), Read 2 (HP11) and Index 1 (HP12)?Also, do I have to design primers for Read 1, Read 2 and Index 1 or the primers provided with reagent kit will do the job?

                  Here are the sequences,

                  Nextera Transposase adapters:

                  TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-target-forward-primer
                  GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-target-reverse-primer

                  Nextera Adapters, P5 and P7:

                  CAAGCAGAAGACGGCATACGAGAT
                  AATGATACGGCGACCACCGAGATCTACAC

                  Here is the link for protocol.
                  Last edited by discoveradnan; 12-01-2015, 10:36 PM.

                  Comment

                  • jwfoley
                    Senior Member
                    • Jun 2009
                    • 183

                    #10
                    Originally posted by discoveradnan View Post
                    Got your point jwfoley. Can you kindly guide me about libraries which are prepared from 2 round PCR? For your reference, I have linked the protocol below.

                    Does the nextera adapters, P5 and P7 (for binding with flow cell) and nextera transposase adapters (for sequencing primers to sequence gene of interest) used by this protocol is compatible with latest MiSeq Reagent Kit v2 flow cell and sequencing primers ,Read 1 (HP10), Read 2 (HP11) and Index 1 (HP12)?Also, do I have to design primers for Read 1, Read 2 and Index 1 or the primers provided with reagent kit will do the job?

                    Here is the link for protocol.
                    https://nematodegenetics.files.wordp...-protocol.docx
                    Your .docx protocol says you can follow the standard MiSeq protocol, so I would do that. Illumina's .pdf protocol has a few special instructions to watch out for. I'm fairly certain the v2 kits support Nextera adapters but I haven't used one, so I can't promise. Illumina support could tell you. Just make sure you create the sample sheet correctly so the MiSeq uses the right primers.
                    Last edited by jwfoley; 12-02-2015, 07:02 AM. Reason: typo

                    Comment

                    • discoveradnan
                      Member
                      • Oct 2015
                      • 23

                      #11
                      Originally posted by jwfoley View Post
                      Your .docx protocol says you can follow the standard MiSeq protocol, so I would do that. Illumina's .pdf protocol has a few special instructions to watch out for. I'm fairly certain the v2 kits support Nextera adapters but I haven't used one, so I can't promise. Illumina support could tell you. Just make sure you create the sample sheet correctly so the MiSeq uses the right primers.
                      Jwfoley can you kindly check my sample sheet. I prepared it according to the protocol I linked. Since Nextera XT adapters and indices are used in this protocol so I also selected same kit for sample sheet preparation. I'm confused about the adapter sequence given in this sheet. Isn't it supposed to match with adapters used in the mentioned protocol? Kindly help me understand it. Thanks

                      Find sample sheet in attachment.
                      Attached Files

                      Comment

                      • jwfoley
                        Senior Member
                        • Jun 2009
                        • 183

                        #12
                        Originally posted by discoveradnan View Post
                        I'm confused about the adapter sequence given in this sheet. Isn't it supposed to match with adapters used in the mentioned protocol?
                        Yes, it is the reverse complement of the Nextera read 1 adapter in the Illumina customer letter: http://support.illumina.com/download...ce-letter.html

                        Comment

                        • discoveradnan
                          Member
                          • Oct 2015
                          • 23

                          #13
                          Originally posted by jwfoley View Post
                          Yes, it is the reverse complement of the Nextera read 1 adapter in the Illumina customer letter: http://support.illumina.com/download...ce-letter.html
                          Thanks a lot jwfoley for being so helpful.

                          Comment

                          Latest Articles

                          Collapse

                          • SEQadmin2
                            New Genomics Technologies Take Aim at Long-Standing Limits
                            by SEQadmin2


                            Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                            We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                            ...
                            Yesterday, 10:25 AM
                          • SEQadmin2
                            How Immunogenomics Decodes Immunity’s Genetic Blueprint
                            by SEQadmin2




                            The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                            This convergence of genetics, immunology, and computation...
                            09-01-2026, 05:41 AM

                          ad_right_rmr

                          Collapse

                          News

                          Collapse

                          Topics Statistics Last Post
                          Started by SEQadmin2, Today, 09:51 AM
                          0 responses
                          7 views
                          0 reactions
                          Last Post SEQadmin2  
                          Started by SEQadmin2, 09-25-2026, 09:06 AM
                          0 responses
                          31 views
                          0 reactions
                          Last Post SEQadmin2  
                          Started by SEQadmin2, 09-23-2026, 11:05 AM
                          0 responses
                          26 views
                          0 reactions
                          Last Post SEQadmin2  
                          Started by SEQadmin2, 09-18-2026, 11:37 AM
                          1 response
                          46 views
                          0 reactions
                          Last Post pekgio
                          by pekgio
                           
                          Working...